ID: 1013292929

View in Genome Browser
Species Human (GRCh38)
Location 6:108734111-108734133
Sequence AGTTTCTGATTCTGCAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013292922_1013292929 19 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292929 6:108734111-108734133 AGTTTCTGATTCTGCAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013292929 Original CRISPR AGTTTCTGATTCTGCAGGTT TGG Intergenic
No off target data available for this crispr