ID: 1013292930

View in Genome Browser
Species Human (GRCh38)
Location 6:108734115-108734137
Sequence TCTGATTCTGCAGGTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013292925_1013292930 -9 Left 1013292925 6:108734101-108734123 CCTCACCCAGAGTTTCTGATTCT No data
Right 1013292930 6:108734115-108734137 TCTGATTCTGCAGGTTTGGAAGG No data
1013292922_1013292930 23 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292930 6:108734115-108734137 TCTGATTCTGCAGGTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013292930 Original CRISPR TCTGATTCTGCAGGTTTGGA AGG Intergenic
No off target data available for this crispr