ID: 1013292931

View in Genome Browser
Species Human (GRCh38)
Location 6:108734116-108734138
Sequence CTGATTCTGCAGGTTTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013292925_1013292931 -8 Left 1013292925 6:108734101-108734123 CCTCACCCAGAGTTTCTGATTCT No data
Right 1013292931 6:108734116-108734138 CTGATTCTGCAGGTTTGGAAGGG No data
1013292922_1013292931 24 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292931 6:108734116-108734138 CTGATTCTGCAGGTTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013292931 Original CRISPR CTGATTCTGCAGGTTTGGAA GGG Intergenic
No off target data available for this crispr