ID: 1013294949

View in Genome Browser
Species Human (GRCh38)
Location 6:108750849-108750871
Sequence GAAAAGGGACTCTGGCGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013294949_1013294956 6 Left 1013294949 6:108750849-108750871 CCTTGGCGCCAGAGTCCCTTTTC No data
Right 1013294956 6:108750878-108750900 GTACACCTCCAATGTCAAGAGGG No data
1013294949_1013294955 5 Left 1013294949 6:108750849-108750871 CCTTGGCGCCAGAGTCCCTTTTC No data
Right 1013294955 6:108750877-108750899 AGTACACCTCCAATGTCAAGAGG No data
1013294949_1013294960 19 Left 1013294949 6:108750849-108750871 CCTTGGCGCCAGAGTCCCTTTTC No data
Right 1013294960 6:108750891-108750913 GTCAAGAGGGTGTGGTGCAGTGG No data
1013294949_1013294958 11 Left 1013294949 6:108750849-108750871 CCTTGGCGCCAGAGTCCCTTTTC No data
Right 1013294958 6:108750883-108750905 CCTCCAATGTCAAGAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013294949 Original CRISPR GAAAAGGGACTCTGGCGCCA AGG (reversed) Intergenic
No off target data available for this crispr