ID: 1013295831

View in Genome Browser
Species Human (GRCh38)
Location 6:108757625-108757647
Sequence GCTTCTATGGTCCCAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013295831_1013295834 20 Left 1013295831 6:108757625-108757647 CCAACTTCTGGGACCATAGAAGC No data
Right 1013295834 6:108757668-108757690 ATGACATATCATGTGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013295831 Original CRISPR GCTTCTATGGTCCCAGAAGT TGG (reversed) Intergenic
No off target data available for this crispr