ID: 1013296414

View in Genome Browser
Species Human (GRCh38)
Location 6:108761809-108761831
Sequence GGGTAGGCACAGATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013296414_1013296420 -3 Left 1013296414 6:108761809-108761831 CCCACCTCCATCTGTGCCTACCC No data
Right 1013296420 6:108761829-108761851 CCCGCTCTGCCTTCCCGCCTTGG No data
1013296414_1013296422 3 Left 1013296414 6:108761809-108761831 CCCACCTCCATCTGTGCCTACCC No data
Right 1013296422 6:108761835-108761857 CTGCCTTCCCGCCTTGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013296414 Original CRISPR GGGTAGGCACAGATGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr