ID: 1013296758

View in Genome Browser
Species Human (GRCh38)
Location 6:108764595-108764617
Sequence ACCTCCATCCTCTCCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013296758_1013296769 27 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296769 6:108764645-108764667 TGGAGGAGGGATGAGTGCGCTGG No data
1013296758_1013296768 14 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296768 6:108764632-108764654 AGTCATAGGATTCTGGAGGAGGG No data
1013296758_1013296770 28 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296770 6:108764646-108764668 GGAGGAGGGATGAGTGCGCTGGG No data
1013296758_1013296763 7 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296763 6:108764625-108764647 CCTGCCCAGTCATAGGATTCTGG No data
1013296758_1013296761 0 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296761 6:108764618-108764640 GTGGAGGCCTGCCCAGTCATAGG No data
1013296758_1013296764 10 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296764 6:108764628-108764650 GCCCAGTCATAGGATTCTGGAGG No data
1013296758_1013296767 13 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296767 6:108764631-108764653 CAGTCATAGGATTCTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013296758 Original CRISPR ACCTCCATCCTCTCCTCTGA TGG (reversed) Intergenic
No off target data available for this crispr