ID: 1013296767

View in Genome Browser
Species Human (GRCh38)
Location 6:108764631-108764653
Sequence CAGTCATAGGATTCTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013296758_1013296767 13 Left 1013296758 6:108764595-108764617 CCATCAGAGGAGAGGATGGAGGT No data
Right 1013296767 6:108764631-108764653 CAGTCATAGGATTCTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013296767 Original CRISPR CAGTCATAGGATTCTGGAGG AGG Intergenic
No off target data available for this crispr