ID: 1013298312

View in Genome Browser
Species Human (GRCh38)
Location 6:108780164-108780186
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013298312_1013298324 28 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298324 6:108780215-108780237 CTCTGGAGGGATCAGGTTCATGG No data
1013298312_1013298314 -8 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298314 6:108780179-108780201 GTGCCCACGAGAGCAAGAGTGGG No data
1013298312_1013298320 11 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298320 6:108780198-108780220 TGGGGCTGGGTAGCTGACTCTGG No data
1013298312_1013298318 -3 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298318 6:108780184-108780206 CACGAGAGCAAGAGTGGGGCTGG No data
1013298312_1013298313 -9 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298313 6:108780178-108780200 GGTGCCCACGAGAGCAAGAGTGG No data
1013298312_1013298315 -7 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298315 6:108780180-108780202 TGCCCACGAGAGCAAGAGTGGGG No data
1013298312_1013298322 15 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298322 6:108780202-108780224 GCTGGGTAGCTGACTCTGGAGGG No data
1013298312_1013298323 21 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298323 6:108780208-108780230 TAGCTGACTCTGGAGGGATCAGG No data
1013298312_1013298321 14 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298321 6:108780201-108780223 GGCTGGGTAGCTGACTCTGGAGG No data
1013298312_1013298319 -2 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298319 6:108780185-108780207 ACGAGAGCAAGAGTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298312 Original CRISPR GTGGGCACCCAGACGTCCCA TGG (reversed) Intergenic