ID: 1013298316

View in Genome Browser
Species Human (GRCh38)
Location 6:108780182-108780204
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013298316_1013298324 10 Left 1013298316 6:108780182-108780204 CCCACGAGAGCAAGAGTGGGGCT No data
Right 1013298324 6:108780215-108780237 CTCTGGAGGGATCAGGTTCATGG No data
1013298316_1013298322 -3 Left 1013298316 6:108780182-108780204 CCCACGAGAGCAAGAGTGGGGCT No data
Right 1013298322 6:108780202-108780224 GCTGGGTAGCTGACTCTGGAGGG No data
1013298316_1013298321 -4 Left 1013298316 6:108780182-108780204 CCCACGAGAGCAAGAGTGGGGCT No data
Right 1013298321 6:108780201-108780223 GGCTGGGTAGCTGACTCTGGAGG No data
1013298316_1013298323 3 Left 1013298316 6:108780182-108780204 CCCACGAGAGCAAGAGTGGGGCT No data
Right 1013298323 6:108780208-108780230 TAGCTGACTCTGGAGGGATCAGG No data
1013298316_1013298320 -7 Left 1013298316 6:108780182-108780204 CCCACGAGAGCAAGAGTGGGGCT No data
Right 1013298320 6:108780198-108780220 TGGGGCTGGGTAGCTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298316 Original CRISPR AGCCCCACTCTTGCTCTCGT GGG (reversed) Intergenic