ID: 1013298317

View in Genome Browser
Species Human (GRCh38)
Location 6:108780183-108780205
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013298317_1013298323 2 Left 1013298317 6:108780183-108780205 CCACGAGAGCAAGAGTGGGGCTG No data
Right 1013298323 6:108780208-108780230 TAGCTGACTCTGGAGGGATCAGG No data
1013298317_1013298322 -4 Left 1013298317 6:108780183-108780205 CCACGAGAGCAAGAGTGGGGCTG No data
Right 1013298322 6:108780202-108780224 GCTGGGTAGCTGACTCTGGAGGG No data
1013298317_1013298320 -8 Left 1013298317 6:108780183-108780205 CCACGAGAGCAAGAGTGGGGCTG No data
Right 1013298320 6:108780198-108780220 TGGGGCTGGGTAGCTGACTCTGG No data
1013298317_1013298321 -5 Left 1013298317 6:108780183-108780205 CCACGAGAGCAAGAGTGGGGCTG No data
Right 1013298321 6:108780201-108780223 GGCTGGGTAGCTGACTCTGGAGG No data
1013298317_1013298324 9 Left 1013298317 6:108780183-108780205 CCACGAGAGCAAGAGTGGGGCTG No data
Right 1013298324 6:108780215-108780237 CTCTGGAGGGATCAGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298317 Original CRISPR CAGCCCCACTCTTGCTCTCG TGG (reversed) Intergenic