ID: 1013298321

View in Genome Browser
Species Human (GRCh38)
Location 6:108780201-108780223
Sequence GGCTGGGTAGCTGACTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013298316_1013298321 -4 Left 1013298316 6:108780182-108780204 CCCACGAGAGCAAGAGTGGGGCT No data
Right 1013298321 6:108780201-108780223 GGCTGGGTAGCTGACTCTGGAGG No data
1013298317_1013298321 -5 Left 1013298317 6:108780183-108780205 CCACGAGAGCAAGAGTGGGGCTG No data
Right 1013298321 6:108780201-108780223 GGCTGGGTAGCTGACTCTGGAGG No data
1013298312_1013298321 14 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298321 6:108780201-108780223 GGCTGGGTAGCTGACTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298321 Original CRISPR GGCTGGGTAGCTGACTCTGG AGG Intergenic
No off target data available for this crispr