ID: 1013298323

View in Genome Browser
Species Human (GRCh38)
Location 6:108780208-108780230
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013298316_1013298323 3 Left 1013298316 6:108780182-108780204 CCCACGAGAGCAAGAGTGGGGCT No data
Right 1013298323 6:108780208-108780230 TAGCTGACTCTGGAGGGATCAGG No data
1013298312_1013298323 21 Left 1013298312 6:108780164-108780186 CCATGGGACGTCTGGGTGCCCAC No data
Right 1013298323 6:108780208-108780230 TAGCTGACTCTGGAGGGATCAGG No data
1013298317_1013298323 2 Left 1013298317 6:108780183-108780205 CCACGAGAGCAAGAGTGGGGCTG No data
Right 1013298323 6:108780208-108780230 TAGCTGACTCTGGAGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298323 Original CRISPR TAGCTGACTCTGGAGGGATC AGG Intergenic