ID: 1013298621

View in Genome Browser
Species Human (GRCh38)
Location 6:108781958-108781980
Sequence CTCTGTGAAGGGCTGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013298612_1013298621 8 Left 1013298612 6:108781927-108781949 CCTATGACTGTTCGATATCTTGT No data
Right 1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298621 Original CRISPR CTCTGTGAAGGGCTGGGGGA GGG Intergenic
No off target data available for this crispr