ID: 1013298822

View in Genome Browser
Species Human (GRCh38)
Location 6:108783708-108783730
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298822 Original CRISPR AAGCAGGATGGGGATTTTCT GGG Intergenic