ID: 1013298903

View in Genome Browser
Species Human (GRCh38)
Location 6:108784637-108784659
Sequence CAAGAAATTCCCACTCTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013298900_1013298903 22 Left 1013298900 6:108784592-108784614 CCATTTCTCCATTCTCATCAACT 0: 1
1: 0
2: 2
3: 79
4: 837
Right 1013298903 6:108784637-108784659 CAAGAAATTCCCACTCTAATAGG 0: 1
1: 0
2: 2
3: 16
4: 195
1013298902_1013298903 14 Left 1013298902 6:108784600-108784622 CCATTCTCATCAACTTTTGGTAT 0: 1
1: 0
2: 1
3: 38
4: 425
Right 1013298903 6:108784637-108784659 CAAGAAATTCCCACTCTAATAGG 0: 1
1: 0
2: 2
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013298903 Original CRISPR CAAGAAATTCCCACTCTAAT AGG Intergenic
903720205 1:25399640-25399662 CAAAAACTTCCCTCTCTAGTCGG + Intronic
904709007 1:32414392-32414414 CAATTAAGTACCACTCTAATTGG - Intergenic
904780544 1:32943622-32943644 AAAGAAATTCCCATTTAAATGGG + Intronic
905678644 1:39849571-39849593 TAAGGAATTCCCAGTCTAGTGGG - Intronic
907076134 1:51580682-51580704 CAAGGAATTCACAATCTAATGGG + Intronic
909801705 1:79818132-79818154 AAAGAAATTCTCTCTATAATGGG - Intergenic
916431469 1:164733247-164733269 CAAGAAGTTCTCAGTCTAGTGGG - Intronic
916582140 1:166118422-166118444 CAATAATTTCACACACTAATAGG + Intronic
919611441 1:199750129-199750151 CAAGAAATCACTACTCTGATGGG - Intergenic
919775156 1:201189634-201189656 CATGAAGTTCACAGTCTAATGGG - Intergenic
920115735 1:203619945-203619967 CAAGCAATTCCCGCTTGAATGGG + Intergenic
920544077 1:206801097-206801119 TTAGAAAATCCCACTCTACTAGG - Intronic
920837380 1:209523981-209524003 CAAGAAATTTCTCTTCTAATGGG - Intergenic
920889953 1:209975230-209975252 CCAGAACTTCCAACACTAATAGG + Intronic
921396748 1:214676655-214676677 CATTAAATTCCCACTTTAACTGG + Intergenic
921819462 1:219600718-219600740 CAAGAGCTTCCCACATTAATAGG - Intergenic
922230671 1:223682830-223682852 CAAGGAATTTCAACTTTAATGGG - Intergenic
922576945 1:226667206-226667228 CAAGGAATGCTCACTCTAGTGGG - Intronic
923798951 1:237187853-237187875 CAAGAAATCCCTGCTCTAAAAGG - Intronic
1064744670 10:18466674-18466696 TAAGAGATTCACACTTTAATGGG + Intronic
1066266433 10:33780324-33780346 CTAGAAATTCCCAATCTTTTGGG - Intergenic
1069359181 10:67622472-67622494 GAAGAAAATCACAGTCTAATAGG + Intronic
1070647101 10:78209597-78209619 CAACAAATTCACAGTCTAAGAGG + Intergenic
1073268778 10:102244370-102244392 CATGAAATTCCCAGCCTATTTGG - Intergenic
1074173063 10:110963921-110963943 CAAGAAACTTGCAATCTAATAGG - Intronic
1074459096 10:113620875-113620897 CAATTAATTCCCCCTTTAATTGG + Intronic
1075839664 10:125489936-125489958 CAGGAAGTTGCCACTCCAATAGG + Intergenic
1079734146 11:23974278-23974300 AAGGAAATTCCCACTCTTAATGG + Intergenic
1081206427 11:40280935-40280957 CAAAAAATTCCAACTCCAAAAGG - Intronic
1083421330 11:62554847-62554869 CAAGGTATTCTCCCTCTAATGGG + Intronic
1085140228 11:74133685-74133707 CAAGGAATTCTCAAGCTAATGGG - Intronic
1086425149 11:86675543-86675565 CAAGGAATTCACAATCTAGTAGG - Intergenic
1086789009 11:91010941-91010963 TTAGAAATAGCCACTCTAATTGG - Intergenic
1087858883 11:103128636-103128658 CAAGAAGTTCACAATCTCATAGG - Intronic
1088373568 11:109117198-109117220 CAAGAATTTAACACTCTAATTGG - Intergenic
1090151450 11:124388808-124388830 AAAGAATTTCACACTCTGATTGG - Intergenic
1093887292 12:24476702-24476724 CAAGGAACTCCCACTCTAATGGG - Intergenic
1095201587 12:39391226-39391248 CAAGAAATTCCAAATCCATTTGG + Intronic
1099080121 12:78167739-78167761 CAAGGAATTCTCCCTCTAAGAGG + Intronic
1100102913 12:91131183-91131205 CAAGAACTTCCCATTATATTTGG - Intergenic
1100736195 12:97535537-97535559 CAAGAAACTCACACTCAGATTGG + Intergenic
1102226790 12:111234510-111234532 CAAAAAATAACCACTCTCATTGG - Intronic
1103272651 12:119686784-119686806 CAGGAATTTCGTACTCTAATAGG + Exonic
1104411946 12:128565761-128565783 CAAGAAATTCACCATCTATTTGG + Intronic
1107026818 13:35810180-35810202 CAATAAATTGAAACTCTAATGGG - Intronic
1109250783 13:60017679-60017701 CAAGAGATTGCCAGTCTAAATGG - Intronic
1112951976 13:105009794-105009816 CAAAATATTCCCATTCAAATTGG - Intergenic
1114829024 14:26116280-26116302 CAAGAAATTTCAACTCTGCTGGG + Intergenic
1117054129 14:51893271-51893293 CTGGAAATTACCACTCTAATGGG + Intronic
1117241780 14:53841037-53841059 CAAGAAGTTTACAATCTAATTGG - Intergenic
1118622253 14:67624248-67624270 CCAGAAATTTGCACTTTAATGGG + Intronic
1118729207 14:68654889-68654911 CAAGACAATCCCACTCCATTTGG + Intronic
1119602353 14:75984947-75984969 CCACAAATTCCCAGCCTAATGGG - Intronic
1120706476 14:87751195-87751217 CAAGAAATTGACATTCTAGTAGG + Intergenic
1120913082 14:89685531-89685553 CAAGCAATTCCAACTTGAATAGG + Intergenic
1125196841 15:37056934-37056956 CACGAAATTCCCACATTCATGGG - Intronic
1127679096 15:61275484-61275506 CAAGAAACTCCCAGGCTAGTGGG + Intergenic
1130539945 15:84815320-84815342 CAAGAAGCTCACAGTCTAATAGG - Intergenic
1133666368 16:7972048-7972070 CAAGGAATTTCCATTCTGATGGG - Intergenic
1133692610 16:8231090-8231112 AAAGAAATTCCCACTTCATTGGG - Intergenic
1137922420 16:52504164-52504186 TAAGAAGTTCACACTCTAAAAGG + Intronic
1138136506 16:54528017-54528039 GAAGAGTTTCCCACTCTATTTGG - Intergenic
1139183979 16:64781896-64781918 CAAGGAATTCAAACTCTATTAGG - Intergenic
1144098629 17:11924196-11924218 AAACAGATTCCCACTCTAATAGG + Intronic
1146390154 17:32414674-32414696 CAAGAAAGTTTCATTCTAATAGG + Intergenic
1147920216 17:43911692-43911714 CCAGAACTTCCCACCCCAATAGG - Intergenic
1149774039 17:59343402-59343424 CAAGAAGTTCCCAGTCTTATGGG + Intronic
1149776444 17:59361480-59361502 CAAGTAATTCACAGGCTAATGGG - Intronic
1150915601 17:69433635-69433657 CTAGAAACTCACATTCTAATGGG + Intronic
1153372652 18:4336801-4336823 CAAGGAGTTTACACTCTAATAGG - Intronic
1155585273 18:27357043-27357065 CAGAAAATTCCAATTCTAATGGG - Intergenic
1155619649 18:27763436-27763458 CAAGAAGTCCCCACTTTAGTTGG + Intergenic
1156332147 18:36132349-36132371 CAAGGAATTCTCAGTCTAGTGGG + Intronic
1157477063 18:48030176-48030198 CATGAAACTCCCACTCTATTAGG + Intronic
1158799998 18:60895060-60895082 CAAGAATTATCCACTGTAATTGG + Intergenic
1159263385 18:66046322-66046344 AAAGCAATTCCCACCCTAGTAGG - Intergenic
1159318961 18:66820625-66820647 CAAGTATTAGCCACTCTAATAGG + Intergenic
1159750555 18:72295775-72295797 CATGAAATTCCTAGTTTAATGGG + Intergenic
1164873388 19:31666184-31666206 AAAGAAATTCCTAATCTAAAAGG + Intergenic
1168258046 19:55177984-55178006 CAAGAACTTCCCAGTCTGGTGGG - Intronic
927261596 2:21097085-21097107 CCAAAAATTCCCACTATATTTGG - Intergenic
927571583 2:24165115-24165137 CAAGAAATTCCCATTCTTTTAGG - Intronic
927599369 2:24427105-24427127 GAAGCAATTCCCACTCTGAGGGG - Intergenic
928061749 2:28120700-28120722 CAAGAAATTCACAATCTATTTGG + Intronic
930339069 2:50089097-50089119 CCAGAATTTCCCAAACTAATGGG + Intronic
931809638 2:65842174-65842196 CTAGAAATTCACAGTATAATAGG - Intergenic
931942879 2:67272463-67272485 CTAGGAATTCACAATCTAATGGG + Intergenic
936799059 2:116244076-116244098 CAAGGAATTTACATTCTAATGGG + Intergenic
942312616 2:174669536-174669558 CAAGTAGTTCACAATCTAATGGG + Intronic
945663307 2:212712429-212712451 CAAGAAATTCCCACTGCAAAAGG - Intergenic
945789520 2:214287480-214287502 CAAGAAAATTCCACTCTTAGAGG - Intronic
1170039334 20:12023678-12023700 CAAAAAATTTCAACTCAAATTGG - Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171961750 20:31499752-31499774 CAAGGAGTTCACAGTCTAATAGG + Intergenic
1173255062 20:41388391-41388413 CAACAAATTTCCAATCAAATTGG + Intergenic
1181864147 22:25841937-25841959 CAAGAAAGTCCCCTTCCAATGGG - Intronic
1182065482 22:27428585-27428607 CAAGACATCCCCAGTCTCATGGG - Intergenic
1182155415 22:28067260-28067282 TAAGAAGTTCTCACTTTAATAGG - Intronic
1182738177 22:32546189-32546211 CAAGAAGCTCACAGTCTAATGGG - Intronic
950394735 3:12725477-12725499 ACAGAAATTCCAACTCAAATTGG + Intergenic
950911099 3:16592817-16592839 CAAGGAATTTACACTCCAATGGG + Intronic
950956360 3:17057736-17057758 CAAGGAGTTTCCACTCTAGTAGG - Intronic
951489498 3:23254006-23254028 CAAGGAACTGCCAGTCTAATAGG + Intronic
952383620 3:32822880-32822902 CAAGAAATTGGCATTTTAATTGG + Intronic
952425922 3:33174359-33174381 CAAGACATTCAGACTCTTATGGG - Intronic
952675580 3:36026361-36026383 AAAGAAATTCTAACTCAAATGGG - Intergenic
957815010 3:85286368-85286390 CAAGAAATGCCCATTCTGATGGG + Intronic
958038360 3:88195965-88195987 CAAGAAATTACCACAAAAATGGG - Intergenic
959081002 3:101801191-101801213 ACAGAAATTACCACTATAATAGG - Intronic
959770867 3:110094057-110094079 CAACAAATTACCATTCTAATAGG - Intergenic
960445653 3:117745953-117745975 CAATAAATTGCCAGTCAAATGGG + Intergenic
961157103 3:124689262-124689284 CAAGAAAGTGCCACTGTACTGGG - Intronic
961524198 3:127486223-127486245 CAACAGATTCCCACTCAAACTGG + Intergenic
962032890 3:131620019-131620041 CAACAAAATCCTCCTCTAATTGG + Intronic
962210082 3:133470600-133470622 AAAGAAGTTTCCAGTCTAATGGG + Intronic
963094601 3:141522761-141522783 CAAGAAATTCCCATTCTTGCAGG + Intronic
963684949 3:148421605-148421627 CAAGAAACTCCCCCTTAAATTGG - Intergenic
965656820 3:170995387-170995409 CAAGGAGTTCACAGTCTAATGGG - Intergenic
966144082 3:176790239-176790261 AAATAAATTCCTACTCTAAAAGG + Intergenic
967225885 3:187290937-187290959 CAAGAACTTCAAATTCTAATTGG - Intronic
967490954 3:190090190-190090212 AAAGAAATTTCCAATCTATTTGG - Intronic
967503757 3:190229989-190230011 CAAGGAATTCCCAATTTCATAGG + Intergenic
974335794 4:60542813-60542835 CAAGAGATTCACAGTATAATGGG - Intergenic
975046978 4:69817627-69817649 CAAGAAATCTAAACTCTAATTGG - Intronic
975359066 4:73445546-73445568 CAAGGAATTCACAGTCTGATAGG + Intronic
975740614 4:77425698-77425720 CAAGAAATTCCCATTCTTGCAGG + Intronic
979200997 4:117977883-117977905 CAAGAAATTCATAATATAATTGG + Intergenic
980099082 4:128523307-128523329 CAAGAAGTTTCCATTCTAGTAGG - Intergenic
980541867 4:134206435-134206457 CAAGAAATTAACACTATATTTGG - Intergenic
980642322 4:135596612-135596634 CAATTAAGTACCACTCTAATTGG - Intergenic
983929501 4:173437589-173437611 TAATAAATTACCACTCTAATTGG - Intergenic
983944577 4:173571050-173571072 CCTAAAATTCCCAGTCTAATGGG + Intergenic
985287289 4:188349380-188349402 AAAGAAATTCCCACTAAACTTGG - Intergenic
988768760 5:34409742-34409764 CAAGAAGTTTACACTTTAATGGG + Intergenic
989755687 5:44950410-44950432 CAAAATATTCCCTTTCTAATTGG - Intergenic
990152506 5:52835274-52835296 TAAGGAATTCCCAGTCTAACAGG + Intronic
990357747 5:54986813-54986835 CAAGAATTACCCACTTTACTGGG - Intronic
990727994 5:58777557-58777579 CAAGAAATTCCCAGTCTTATGGG - Intronic
992643780 5:78793414-78793436 CAGGAAGTTTCTACTCTAATTGG + Intronic
993418968 5:87676066-87676088 CAAAAAATTCACATTCTAATTGG + Intergenic
994022758 5:95046810-95046832 CTAGGAATTCACAGTCTAATAGG - Intronic
995883894 5:116871321-116871343 CTAGACATTCCCATTCTAAATGG - Intergenic
998540398 5:142976064-142976086 CGAGAAATTCTCACTCTATCTGG + Intronic
999502829 5:152163941-152163963 CAAGAACTTCTCAGTGTAATAGG - Intergenic
1000719592 5:164690632-164690654 CCAGAGATTCCCACTCTAGAGGG - Intergenic
1001182824 5:169536690-169536712 AAAGAAAATGCCACTCTTATTGG - Intergenic
1001972024 5:175964195-175964217 CAAGGAATTCACAGTCTAACAGG + Intronic
1002198656 5:177514557-177514579 CAAGGAGCTCCCAGTCTAATGGG - Intronic
1002245418 5:177879582-177879604 CAAGGAATTCACAGTCTAACAGG - Intergenic
1002363919 5:178695533-178695555 CAAGAAATTCCCATTCTTGCAGG + Intergenic
1003056570 6:2826141-2826163 CAAGCAATTCCCAGTCTACCTGG + Intergenic
1007802330 6:44406573-44406595 TAAGAAATTCACAGTTTAATGGG + Intronic
1009566188 6:65313872-65313894 CAAGAGCTTCCCACATTAATAGG + Intronic
1013298903 6:108784637-108784659 CAAGAAATTCCCACTCTAATAGG + Intergenic
1013434336 6:110087044-110087066 CAAGATTTTCACAGTCTAATTGG + Intergenic
1019857654 7:3625629-3625651 TCAGAAGTGCCCACTCTAATGGG + Intronic
1020272555 7:6606040-6606062 CAAGAAGTTTCCAGTCTATTTGG - Intronic
1021410700 7:20327356-20327378 TAAGAACTTCCTACTTTAATGGG - Intergenic
1024439740 7:49403540-49403562 CACAAAATTTCCATTCTAATGGG - Intergenic
1024810451 7:53205203-53205225 CAAGAGACTCCCACTGGAATTGG + Intergenic
1027342470 7:77223816-77223838 CAAGGAATGCACAGTCTAATGGG + Intronic
1027535561 7:79396015-79396037 CAAGAAATCCCCAGCCTTATAGG - Intronic
1027938674 7:84642832-84642854 AAGGAAATTCCCACTATGATGGG + Intergenic
1027979805 7:85202805-85202827 AAAGAGATTGCCATTCTAATTGG - Intergenic
1028241436 7:88425690-88425712 CAAGAGATGTCCATTCTAATAGG + Intergenic
1028459996 7:91081602-91081624 CAAGAAATTCCTACTCTCTTAGG - Intronic
1028906444 7:96159778-96159800 AAATAAATTCTTACTCTAATTGG + Intronic
1029026779 7:97424782-97424804 AAAGATATTCCCACACAAATGGG + Intergenic
1029164844 7:98580531-98580553 CAAGAAATAACCACTAAAATAGG - Intergenic
1030896124 7:115062279-115062301 ACAGAAAATCCCACTCAAATTGG - Intergenic
1030984567 7:116226251-116226273 CAAGAAGCTCACAATCTAATGGG + Intronic
1031376119 7:121027853-121027875 CAAGAGTTCCCCACTCTAAATGG - Intronic
1032065874 7:128770246-128770268 AAAAAAATCCCCACTCTACTGGG - Exonic
1032348280 7:131136950-131136972 CAAGAAACTCACAGTCCAATGGG - Intronic
1033378873 7:140792702-140792724 CAAGGAAGTCACAGTCTAATAGG - Intronic
1035023296 7:155811137-155811159 CAATACATTCACACTCTGATGGG + Intronic
1035121252 7:156569727-156569749 AAAAAAATTCCCAGTGTAATTGG - Intergenic
1035680831 8:1486536-1486558 CGAGAAATTCCCCCTTTGATTGG - Intergenic
1035703176 8:1652967-1652989 CAGGAAATTGCGACTCTCATGGG - Intronic
1035981557 8:4378168-4378190 CTAGATATTGCGACTCTAATCGG + Intronic
1038777493 8:30544181-30544203 CAGGAAATTCCCACTGTTTTGGG + Intronic
1040601593 8:48890201-48890223 CAAGAAACTACCACTCTAGCAGG + Intergenic
1041638445 8:60170780-60170802 CAAGAAATTATCACGCTCATGGG + Intergenic
1042799553 8:72703723-72703745 CAAAAAAATCTCACTGTAATAGG + Intronic
1044226133 8:89720744-89720766 AAAGAAATCCCCATTCTAACTGG + Intergenic
1046429510 8:114106688-114106710 CAAGAAGCTCACAATCTAATGGG + Intergenic
1047111025 8:121789709-121789731 CAAGAAGTTCACAGTCTAAATGG + Intergenic
1047536615 8:125725922-125725944 CAAGAAATTTACATTCTAGTTGG + Intergenic
1047656104 8:126979087-126979109 GAAGAAATTCCCAATCTGCTTGG - Intergenic
1047734187 8:127751412-127751434 CAAGTAGTTCCAATTCTAATGGG - Intergenic
1047777675 8:128086878-128086900 CAAGAAACTTCCAGTCCAATAGG - Intergenic
1048744182 8:137594782-137594804 CAAGAAGTTCACAGTCTACTGGG + Intergenic
1051521776 9:17997230-17997252 CAAAAACTTTCCATTCTAATAGG - Intergenic
1051574272 9:18597015-18597037 TAAGAAGTTCTCAATCTAATTGG - Intronic
1051868379 9:21708158-21708180 CAAAATGTTCCCACTCTCATTGG - Intergenic
1053348133 9:37393196-37393218 CAAGGATCTCCCACTCTGATGGG - Intergenic
1055999957 9:82204848-82204870 CAACAAATCCCTACTCTAAAGGG - Intergenic
1056198689 9:84253552-84253574 CAAGAAACTTACAATCTAATGGG - Intergenic
1057359194 9:94357811-94357833 CAAGAAAATCCCATTATATTTGG + Intergenic
1057648567 9:96899779-96899801 CAAGAAAATCCCATTATATTTGG - Intronic
1057814489 9:98284752-98284774 CAAGAAGCTCACACACTAATAGG - Intergenic
1059723158 9:116981165-116981187 CAAGAAATTCCCAGCTTAGTGGG - Intronic
1059726448 9:117013050-117013072 CAAGAAATGCACAATCTGATGGG - Intronic
1060691602 9:125665921-125665943 CAAGAAGTTCGAAGTCTAATAGG - Intronic
1062596094 9:137300339-137300361 CAAGAGATTCACAGTCTTATAGG + Intergenic
1186816748 X:13245782-13245804 CATGGAATTTCCACTCTACTGGG + Intergenic
1187312500 X:18158814-18158836 GAAGAAACTCCCACTCCAACGGG - Intergenic
1187573183 X:20526394-20526416 CAAGAAATTTACACTTTAATTGG - Intergenic
1188252195 X:27910683-27910705 CAAGAACATCCCACTGGAATGGG - Intergenic
1195482884 X:105368156-105368178 CAGGAATTTCTCACTCTCATAGG + Intronic
1196598418 X:117571738-117571760 CAGGGAATTCGCAGTCTAATAGG - Intergenic
1197489214 X:127096731-127096753 CAAGAAACTCCCACTCAAAAGGG - Intergenic
1197940799 X:131787263-131787285 TAAGTAATTCCCATTCTAGTGGG + Intergenic
1198225634 X:134642483-134642505 CAAGGAATTTGCAGTCTAATAGG + Intronic