ID: 1013299959

View in Genome Browser
Species Human (GRCh38)
Location 6:108795580-108795602
Sequence AAGCTAAAAGCACCTCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013299959_1013299961 1 Left 1013299959 6:108795580-108795602 CCAGGGAGAGGTGCTTTTAGCTT No data
Right 1013299961 6:108795604-108795626 TAGAAGCAAGAGGAGCCACCTGG No data
1013299959_1013299962 13 Left 1013299959 6:108795580-108795602 CCAGGGAGAGGTGCTTTTAGCTT No data
Right 1013299962 6:108795616-108795638 GAGCCACCTGGTTCTTCTCTTGG No data
1013299959_1013299960 -9 Left 1013299959 6:108795580-108795602 CCAGGGAGAGGTGCTTTTAGCTT No data
Right 1013299960 6:108795594-108795616 TTTTAGCTTTTAGAAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013299959 Original CRISPR AAGCTAAAAGCACCTCTCCC TGG (reversed) Intergenic
No off target data available for this crispr