ID: 1013299960

View in Genome Browser
Species Human (GRCh38)
Location 6:108795594-108795616
Sequence TTTTAGCTTTTAGAAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013299959_1013299960 -9 Left 1013299959 6:108795580-108795602 CCAGGGAGAGGTGCTTTTAGCTT No data
Right 1013299960 6:108795594-108795616 TTTTAGCTTTTAGAAGCAAGAGG No data
1013299958_1013299960 2 Left 1013299958 6:108795569-108795591 CCATCTTCTGTCCAGGGAGAGGT No data
Right 1013299960 6:108795594-108795616 TTTTAGCTTTTAGAAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013299960 Original CRISPR TTTTAGCTTTTAGAAGCAAG AGG Intergenic
No off target data available for this crispr