ID: 1013299962

View in Genome Browser
Species Human (GRCh38)
Location 6:108795616-108795638
Sequence GAGCCACCTGGTTCTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013299958_1013299962 24 Left 1013299958 6:108795569-108795591 CCATCTTCTGTCCAGGGAGAGGT No data
Right 1013299962 6:108795616-108795638 GAGCCACCTGGTTCTTCTCTTGG No data
1013299959_1013299962 13 Left 1013299959 6:108795580-108795602 CCAGGGAGAGGTGCTTTTAGCTT No data
Right 1013299962 6:108795616-108795638 GAGCCACCTGGTTCTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013299962 Original CRISPR GAGCCACCTGGTTCTTCTCT TGG Intergenic
No off target data available for this crispr