ID: 1013300867

View in Genome Browser
Species Human (GRCh38)
Location 6:108803854-108803876
Sequence GGTCACCAGGGACCTCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013300867_1013300880 15 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300880 6:108803892-108803914 CATGGGTGGAGCATGGGTGGAGG No data
1013300867_1013300874 -2 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300874 6:108803875-108803897 CCCAGCAAGAGCAAGGGCATGGG No data
1013300867_1013300883 26 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300883 6:108803903-108803925 CATGGGTGGAGGGGAGTGAGTGG No data
1013300867_1013300878 9 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300878 6:108803886-108803908 CAAGGGCATGGGTGGAGCATGGG No data
1013300867_1013300876 1 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300876 6:108803878-108803900 AGCAAGAGCAAGGGCATGGGTGG No data
1013300867_1013300881 16 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300881 6:108803893-108803915 ATGGGTGGAGCATGGGTGGAGGG No data
1013300867_1013300879 12 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300879 6:108803889-108803911 GGGCATGGGTGGAGCATGGGTGG No data
1013300867_1013300871 -8 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300871 6:108803869-108803891 TGGTGACCCAGCAAGAGCAAGGG No data
1013300867_1013300882 17 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300882 6:108803894-108803916 TGGGTGGAGCATGGGTGGAGGGG No data
1013300867_1013300870 -9 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG No data
1013300867_1013300872 -3 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300872 6:108803874-108803896 ACCCAGCAAGAGCAAGGGCATGG No data
1013300867_1013300877 8 Left 1013300867 6:108803854-108803876 CCAGATGGAGGTCCCTGGTGACC No data
Right 1013300877 6:108803885-108803907 GCAAGGGCATGGGTGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013300867 Original CRISPR GGTCACCAGGGACCTCCATC TGG (reversed) Intergenic
No off target data available for this crispr