ID: 1013304845

View in Genome Browser
Species Human (GRCh38)
Location 6:108838503-108838525
Sequence CCCCTAGGGCACTCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013304845_1013304852 12 Left 1013304845 6:108838503-108838525 CCCACCTCAGAGTGCCCTAGGGG No data
Right 1013304852 6:108838538-108838560 GCCACGCCCTCCTCAAGAAAAGG No data
1013304845_1013304857 27 Left 1013304845 6:108838503-108838525 CCCACCTCAGAGTGCCCTAGGGG No data
Right 1013304857 6:108838553-108838575 AGAAAAGGCACTTGCAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013304845 Original CRISPR CCCCTAGGGCACTCTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr