ID: 1013304925

View in Genome Browser
Species Human (GRCh38)
Location 6:108838954-108838976
Sequence GTCCATCTGGGTCACGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013304925_1013304930 -2 Left 1013304925 6:108838954-108838976 CCCACTCCGTGACCCAGATGGAC No data
Right 1013304930 6:108838975-108838997 ACAAGAAGTGTAATACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013304925 Original CRISPR GTCCATCTGGGTCACGGAGT GGG (reversed) Intergenic
No off target data available for this crispr