ID: 1013305515

View in Genome Browser
Species Human (GRCh38)
Location 6:108843846-108843868
Sequence ATTCGCTGCCTGGGATAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013305515_1013305528 27 Left 1013305515 6:108843846-108843868 CCCACCTATCCCAGGCAGCGAAT No data
Right 1013305528 6:108843896-108843918 AGATGGTGCTGAAGCTCTCCAGG No data
1013305515_1013305522 -7 Left 1013305515 6:108843846-108843868 CCCACCTATCCCAGGCAGCGAAT No data
Right 1013305522 6:108843862-108843884 AGCGAATCAGTTCATCTGGGTGG No data
1013305515_1013305525 1 Left 1013305515 6:108843846-108843868 CCCACCTATCCCAGGCAGCGAAT No data
Right 1013305525 6:108843870-108843892 AGTTCATCTGGGTGGGTTCTGGG No data
1013305515_1013305521 -10 Left 1013305515 6:108843846-108843868 CCCACCTATCCCAGGCAGCGAAT No data
Right 1013305521 6:108843859-108843881 GGCAGCGAATCAGTTCATCTGGG No data
1013305515_1013305526 10 Left 1013305515 6:108843846-108843868 CCCACCTATCCCAGGCAGCGAAT No data
Right 1013305526 6:108843879-108843901 GGGTGGGTTCTGGGCCGAGATGG No data
1013305515_1013305523 -6 Left 1013305515 6:108843846-108843868 CCCACCTATCCCAGGCAGCGAAT No data
Right 1013305523 6:108843863-108843885 GCGAATCAGTTCATCTGGGTGGG No data
1013305515_1013305524 0 Left 1013305515 6:108843846-108843868 CCCACCTATCCCAGGCAGCGAAT No data
Right 1013305524 6:108843869-108843891 CAGTTCATCTGGGTGGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013305515 Original CRISPR ATTCGCTGCCTGGGATAGGT GGG (reversed) Intergenic
No off target data available for this crispr