ID: 1013308605

View in Genome Browser
Species Human (GRCh38)
Location 6:108872734-108872756
Sequence AAGGGTTTTCAGCAAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013308605_1013308615 27 Left 1013308605 6:108872734-108872756 CCACCCTCTTGCTGAAAACCCTT 0: 1
1: 0
2: 5
3: 38
4: 296
Right 1013308615 6:108872784-108872806 GTTTGCCAAACTGAGTTCCAGGG 0: 1
1: 0
2: 4
3: 32
4: 266
1013308605_1013308614 26 Left 1013308605 6:108872734-108872756 CCACCCTCTTGCTGAAAACCCTT 0: 1
1: 0
2: 5
3: 38
4: 296
Right 1013308614 6:108872783-108872805 TGTTTGCCAAACTGAGTTCCAGG 0: 1
1: 0
2: 4
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013308605 Original CRISPR AAGGGTTTTCAGCAAGAGGG TGG (reversed) Intronic
900468455 1:2837687-2837709 AAGGGTGTTCAGCCACAGTGGGG - Intergenic
900756461 1:4438552-4438574 GAGGTTTTTGAGCAAGTGGGTGG - Intergenic
900837628 1:5017949-5017971 GAGGGTTTTCAGCAAAAGAGAGG + Intergenic
901061146 1:6472467-6472489 GAGGGCTGTCAGAAAGAGGGGGG + Intronic
902264840 1:15255924-15255946 ATGGATTTTCAGCAAGTGGAAGG + Intronic
902831299 1:19014650-19014672 ATTTGTTTGCAGCAAGAGGGAGG + Intergenic
903825839 1:26145289-26145311 AAGGGTTATCCACCAGAGGGCGG - Intergenic
904377310 1:30090016-30090038 AAGGGTTTTAAGCAAGGAAGTGG + Intergenic
904413391 1:30339328-30339350 CAGAGTTTTAAGCAAGAGAGTGG + Intergenic
904615897 1:31749461-31749483 AAGGGTACACAGCAAGACGGTGG - Intronic
904818172 1:33220985-33221007 AAGGGTCAGCAGAAAGAGGGTGG + Intergenic
905108936 1:35580366-35580388 AAGGGGTTGGAGCAAGAGGAAGG - Intronic
905537336 1:38732796-38732818 AAGGGTTTTAAGCAGGGGAGTGG - Intergenic
905776400 1:40670130-40670152 AAGCATTTTCAGTAAGAGAGGGG - Intergenic
909476111 1:76082486-76082508 AAGGTTTGTCAGCAGGAGAGTGG + Intronic
910445323 1:87294144-87294166 AAGTGTTTTCAATAAGAGGGTGG - Intergenic
910810653 1:91232284-91232306 AAAGATTTTCATCAAAAGGGGGG + Intergenic
911063818 1:93770084-93770106 AAGGCTTTTCAGCAAGATAGTGG + Intronic
912272238 1:108223332-108223354 AAGCGTTTTCAGCAAGAACATGG + Exonic
914378976 1:147099475-147099497 AAGTGCTTTCAGCAAGAACGTGG + Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
916556599 1:165899215-165899237 AAGGGTTTCCATCAGGAAGGAGG - Intronic
917297719 1:173539218-173539240 TAGGGTTTTAAGCAGGAAGGAGG + Intronic
917612279 1:176700612-176700634 AAGGGTTTCCAGCAGCAGAGAGG + Intronic
919569519 1:199229108-199229130 AAAGGTTTTCAGGAACAGGGAGG + Intergenic
920979912 1:210823519-210823541 GAGGGTTTTAAGCAAGAAAGAGG - Intronic
921126010 1:212178741-212178763 AAGGGTTTTTGGTGAGAGGGAGG - Intergenic
921945292 1:220882021-220882043 AAGGGCTTTCTGAATGAGGGTGG + Intronic
922076822 1:222253513-222253535 TAGGCTTTTCAGCTTGAGGGTGG - Intergenic
924615874 1:245611652-245611674 AAGGGTTTTCAGCCTTAGAGGGG + Intronic
1064838848 10:19566500-19566522 AAGATTTTTTAGTAAGAGGGAGG + Intronic
1065737674 10:28769215-28769237 AAGAGGTTTCAGCAGGAGAGCGG + Intergenic
1067842066 10:49688879-49688901 AAGGGAGATCAGGAAGAGGGAGG - Intronic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068056824 10:52021313-52021335 ATGGATTTTAAGCAGGAGGGAGG + Intronic
1069137749 10:64785420-64785442 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1069270699 10:66523849-66523871 AAAGGTTATCAGCAAGTGGGGGG - Intronic
1069344808 10:67456400-67456422 ATGGGTTATCAGAAAAAGGGAGG - Intronic
1070801334 10:79246154-79246176 AAGGTCATCCAGCAAGAGGGTGG + Intronic
1073751538 10:106533703-106533725 AAGGCTTTTGAAGAAGAGGGGGG - Intergenic
1075059583 10:119246383-119246405 AAGAGTTTTCAGTTGGAGGGTGG + Intronic
1076648173 10:131969020-131969042 AAGGCTTTTCGGCAATAGAGAGG + Intronic
1077891668 11:6422361-6422383 AAGGGTTTGAAGCAGGAGAGGGG + Intergenic
1078547113 11:12254452-12254474 AAGGGGTCTCTGGAAGAGGGTGG + Intronic
1079112835 11:17614603-17614625 AATGGTTGTCAGCAGGAGGGGGG - Intronic
1079388457 11:20000978-20001000 AAGGGTTTTCAGCAGGCAGGTGG - Intronic
1079392390 11:20033901-20033923 TAGGGCTTTCAGCAAGACTGTGG + Intronic
1080110413 11:28560644-28560666 AAGGTTTTTCAGCTATAGGGGGG - Intergenic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1083192560 11:61062797-61062819 AAGCGTTTCCAGTAAGAGGAGGG + Intergenic
1085115547 11:73928408-73928430 AAGGGTTTTAAGCAAGAGAATGG + Intergenic
1085323937 11:75592474-75592496 GAGGGTTTTGAGGGAGAGGGAGG - Intronic
1085471087 11:76758596-76758618 GAGGGTTTTGAGCAAGGAGGTGG + Intergenic
1086738429 11:90336992-90337014 AAAGGTTTTCAGCAATAAAGTGG - Intergenic
1086933196 11:92715997-92716019 AAGGTTTTTGAGCAGGATGGTGG + Intronic
1087005477 11:93466752-93466774 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1088124587 11:106408648-106408670 AAGGTTTTTAATCAGGAGGGTGG - Intergenic
1088136774 11:106564988-106565010 AAGGGTTGTAAGCATGATGGTGG - Intergenic
1088833525 11:113558198-113558220 AAATGTTCTCTGCAAGAGGGAGG - Intergenic
1089654042 11:119934268-119934290 AAGGTTTTTAATCAAGGGGGTGG - Intergenic
1089910551 11:122095627-122095649 AAGTGGTTTTAGAAAGAGGGTGG + Intergenic
1089981982 11:122780192-122780214 AATGGTTTTCAGCAAGTTGAAGG - Intronic
1090475838 11:127019135-127019157 CAGTGTTTTCAGCAGGAAGGAGG + Intergenic
1091566263 12:1650652-1650674 AAAGGCCTGCAGCAAGAGGGAGG - Intergenic
1091601064 12:1918088-1918110 AGGGCTTTACAGCAAGAGAGTGG + Intronic
1093438378 12:19164116-19164138 AAGCCTTTTCAGAAAGGGGGTGG - Intronic
1096283286 12:50275650-50275672 AAAGGATTTCAACAAGAGGGTGG + Intronic
1096484613 12:51970229-51970251 AAGTGTTGTCAGAAAGAGCGTGG + Intronic
1097805480 12:63960489-63960511 AAGGATTTTCATCAAGAAAGTGG - Intronic
1100783513 12:98054847-98054869 AAGGGTTTTCAGCACGGGTGTGG - Intergenic
1101099324 12:101376466-101376488 AAAGGTTTTTAGCAACAGGCTGG - Intronic
1101148824 12:101866337-101866359 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1101517799 12:105452965-105452987 AAGGGTTTTAAGCAAGGGTTTGG - Intergenic
1102143821 12:110638887-110638909 AAGGGGTTTCAGCATGGAGGGGG - Intronic
1102550776 12:113690395-113690417 AACTGTTTTCTGCAAGAGAGCGG + Intergenic
1103112174 12:118290140-118290162 AAGGGTTTTAAGTTAGAGAGTGG - Intronic
1103167456 12:118782678-118782700 AAGGGGTTTAAGCCAGAGGAAGG + Intergenic
1103480949 12:121249358-121249380 AAGTGCTTTCTGCAAGAGGGTGG + Intronic
1103739859 12:123083880-123083902 AGGAGTTTTCAGAGAGAGGGAGG - Intronic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1104609585 12:130217289-130217311 AAGGGTTTTCAGCAACTGTTTGG + Intergenic
1105299434 13:19118930-19118952 AAGGTTTTGCAGAAAGACGGCGG + Intergenic
1105430476 13:20332852-20332874 AAGAGCTGTCAGCAAGAGGAGGG - Intergenic
1107217210 13:37935191-37935213 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1111182593 13:84687904-84687926 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1111606468 13:90546024-90546046 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1112547216 13:100382488-100382510 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
1114626749 14:24135547-24135569 AAGGGTTTTAAGCCAGAGAGAGG + Intergenic
1115170306 14:30497410-30497432 ATGGGTTTTCAGCAAGGGAATGG - Intergenic
1116491418 14:45507761-45507783 AAGGGTGTTTATCAAGAGGAAGG + Intergenic
1118969553 14:70621864-70621886 GAGTGTTGTCAGCAAGATGGTGG + Intergenic
1120372778 14:83658380-83658402 AAGGGTTTTAAGCAAGCAAGTGG - Intergenic
1121479003 14:94245422-94245444 AAGACTTTTCAGCAAGAAGATGG + Intronic
1123725886 15:23101168-23101190 CAGGAATTTCAGCCAGAGGGTGG + Intergenic
1123798630 15:23798553-23798575 AAAGGGTTTGACCAAGAGGGTGG + Intergenic
1124798744 15:32808956-32808978 AAGGCTTTTCTACAAAAGGGTGG + Intronic
1125497413 15:40209621-40209643 TAGGGTTTTCTGCCAGTGGGAGG - Exonic
1125513373 15:40304599-40304621 AAGGGTTTTCAGAAGTTGGGGGG - Intronic
1127462885 15:59215878-59215900 AAGGCTGGTCAGCAAGGGGGTGG - Intronic
1127647093 15:60969732-60969754 CATGGTTTTCAGCATAAGGGAGG + Intronic
1128614007 15:69095362-69095384 AAGGGTTTTAAGCAGTGGGGAGG - Intergenic
1129887360 15:79047991-79048013 AAGGGCTTTCTCAAAGAGGGAGG + Intronic
1131259043 15:90879211-90879233 AAGGGGGTTCAACTAGAGGGTGG - Intronic
1131693787 15:94854666-94854688 AGAGGTCTTCAGCAAGAGTGAGG + Intergenic
1132688196 16:1171045-1171067 AAGGGTGTGCAGGAAGAGGGAGG - Intronic
1133268235 16:4597455-4597477 AAGGGCTGTCATCTAGAGGGAGG + Intronic
1133685637 16:8162898-8162920 AAGGAGTTTCAGCAAGTGGTAGG + Intergenic
1134225947 16:12390283-12390305 GAGGGATTTAAGCAAGAGAGAGG - Intronic
1135116980 16:19732175-19732197 AAGGGTTTTCTGGAAGAGACTGG - Intronic
1135206628 16:20490502-20490524 AAAGGCTTTTAGCAAGAAGGAGG - Intergenic
1135212258 16:20533130-20533152 AAAGGCTTTTAGCAAGAAGGAGG + Intergenic
1135256987 16:20948809-20948831 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
1135405484 16:22194682-22194704 AAGGCTTTTGAGCTAGAGAGTGG - Intergenic
1135511354 16:23086765-23086787 AAGGGTTTTAAGGAAGAATGTGG + Intronic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1136058209 16:27706482-27706504 AAGTGGTCTCAGCAAGAGCGGGG + Intronic
1137464827 16:48698401-48698423 AAGGGTTTTAAGCGGGTGGGGGG + Intergenic
1137974817 16:53022438-53022460 TGAGGTGTTCAGCAAGAGGGGGG - Intergenic
1138440026 16:57028635-57028657 CTGGGATTTCAGAAAGAGGGAGG - Intronic
1138679514 16:58674913-58674935 AAGTGTTTTAAGCAGGGGGGTGG - Intronic
1139450357 16:67024339-67024361 AGGGGTCTTAAGCAAAAGGGTGG + Intergenic
1143163280 17:4885152-4885174 AGGGATTTTCAGCAGGAGGCAGG - Intronic
1143253248 17:5537867-5537889 AAGGCTCTTCAGCATAAGGGAGG + Intronic
1144162727 17:12577756-12577778 AAGGGTTTTGAGCAAGAAGGTGG - Intergenic
1144825472 17:18103389-18103411 CAGGGATTTCAGCAAGAAGAGGG - Intronic
1145193705 17:20868871-20868893 AAGGTTTTGCAGAAAGACGGTGG + Intronic
1145202835 17:20962298-20962320 AAAGGTGTTCAGCCAGTGGGGGG - Intergenic
1145298316 17:21612233-21612255 AAAGTTTTGCAGAAAGAGGGTGG - Intergenic
1145404127 17:22570873-22570895 AAGGTTTTGCAGAAAGACGGTGG + Intergenic
1145722767 17:27088884-27088906 AAGGTTTTGCAGAAAGACGGTGG - Intergenic
1147513405 17:41093686-41093708 AAGGCTTTTCAGCTTGAAGGTGG - Intronic
1147515495 17:41113981-41114003 AAGGCTTTTCAGCTTGAAGGTGG - Intergenic
1148399530 17:47343466-47343488 CAATGTTTTCAGCAAGAGTGGGG - Intronic
1150487483 17:65554031-65554053 AAGGGTTTTCAGCCTGCAGGTGG + Intronic
1150564761 17:66328972-66328994 AAGGGCTTTAAGCAAGGAGGTGG + Intronic
1150660254 17:67069040-67069062 AAGGCTTTTCAGCAAAAGAGTGG + Intergenic
1153709437 18:7783202-7783224 AAGGGTGATCAGCAAGGGGATGG + Intronic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156117150 18:33799139-33799161 AAGGGTTTTCAAGCAGAGGAAGG - Intergenic
1157792513 18:50545502-50545524 CAGGCTTTTCAGCTGGAGGGTGG - Intergenic
1158121962 18:54058381-54058403 AGGGTTTTTCAGAAAGTGGGTGG - Intergenic
1158531186 18:58263174-58263196 AATGGTTTCCAGAAATAGGGAGG - Intronic
1159030577 18:63226358-63226380 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
1159075562 18:63677788-63677810 AAGAGTTTTAAGCATGTGGGTGG + Intronic
1159554750 18:69933409-69933431 AAGGGCTGGCAGGAAGAGGGAGG - Intronic
1159710285 18:71749642-71749664 AAGTGTTTTCTGCAGGTGGGGGG - Intronic
1159860613 18:73644331-73644353 AAGGGTTGTCAGGAAGGTGGAGG + Intergenic
1159863393 18:73675535-73675557 AAGGAGTTTCAGGAAGAGGAGGG - Intergenic
1160449344 18:78951615-78951637 GAGAGTTTTCAGCATCAGGGTGG - Intergenic
1161877972 19:6926613-6926635 CAGGGTCTTCAGGAAGAGAGAGG - Intronic
1165560131 19:36671955-36671977 AAGGTATTGTAGCAAGAGGGGGG - Intergenic
1166782716 19:45350814-45350836 AAGGTTCTTGAGCAAGATGGGGG - Exonic
1166912692 19:46171320-46171342 AAGGGGAGTCAGCCAGAGGGAGG + Intergenic
1166990581 19:46690304-46690326 AAGGCTTTTGAGCAAGGGAGGGG - Intronic
1167874323 19:52398744-52398766 AAGGCTTCTCAGACAGAGGGGGG + Intronic
1168296458 19:55379359-55379381 AGGGGTTGTCTGCAGGAGGGAGG + Exonic
925134252 2:1515327-1515349 ATGGGCTTTTAGCAAGAGGCTGG + Intronic
925882356 2:8363446-8363468 GGGGGTTTTCAGCAAGAGGGAGG - Intergenic
926045852 2:9709049-9709071 AAGTCATTTCAGAAAGAGGGAGG + Intergenic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
926790011 2:16561191-16561213 AAGGGTTTTCAGCATTGGCGTGG + Exonic
927149057 2:20185442-20185464 AAGGGCTTCCAGGAAGAGGCAGG - Intergenic
927876356 2:26658027-26658049 AAGGATATTAAGCAAGATGGTGG - Intergenic
928712468 2:34022681-34022703 AAGGGTTTTAAGCAAGAGGATGG + Intergenic
929370376 2:41216478-41216500 AAGGTTTTCAAGTAAGAGGGTGG - Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
931119213 2:59197828-59197850 ATGGGTTTTAAGGAAAAGGGAGG + Intergenic
931171925 2:59812800-59812822 AAGGGTCTAAAGCAGGAGGGTGG - Intergenic
931462902 2:62463703-62463725 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
931868086 2:66433261-66433283 AAGAGTTTTGAGCAAGATTGGGG - Intergenic
932114403 2:69033264-69033286 AAGCTTTTTGAGCAAGAGGGAGG + Intronic
932634286 2:73374457-73374479 AGGGTTATTGAGCAAGAGGGAGG + Intergenic
935854703 2:107261194-107261216 AAGACTTTTCAGCAAGACAGTGG + Intergenic
936656547 2:114494757-114494779 CAGGGTTTTCTGCAAGAGTAAGG + Intronic
936826954 2:116593441-116593463 TAGGGATTTCAACAGGAGGGTGG - Intergenic
937474319 2:122201569-122201591 AAGAGTTTTGAGGAAGAGGGAGG - Intergenic
938287532 2:130129982-130130004 AAGGTTTTGCAGAAAGATGGTGG + Intergenic
938428060 2:131208877-131208899 AAGGTTTTGCAGAAAGATGGTGG - Intronic
938615835 2:132997283-132997305 TTGGGTTTTCAGGAAGATGGTGG + Intronic
941451691 2:165667624-165667646 AAGGATTTAAAGCAAAAGGGAGG - Intronic
941612806 2:167682493-167682515 AAGACTTTTAAGCAAGAGAGGGG - Intergenic
941908368 2:170738586-170738608 GATGGATTTCAGGAAGAGGGTGG - Intergenic
942049141 2:172122389-172122411 AAAGGTTTTCATTAAGAGAGAGG + Intergenic
946084644 2:217158254-217158276 GGGGGTCTTCAGGAAGAGGGTGG - Intergenic
947438113 2:230090861-230090883 AAGCCTGTTCAGCAAGAGGCTGG - Intergenic
947842005 2:233213783-233213805 AATGGTTTGCAGGCAGAGGGTGG + Intronic
947951082 2:234147845-234147867 TAGAGTGATCAGCAAGAGGGTGG + Intergenic
948655138 2:239471893-239471915 AAGAGTTTTCAGCAGCAGAGTGG + Intergenic
948787107 2:240358478-240358500 AAGGGTGTTCAGGACTAGGGAGG - Intergenic
1169023430 20:2347849-2347871 AAGGTTTATCATCAAGGGGGTGG + Intergenic
1169586590 20:7092570-7092592 AAGGGTTTTCAGGCTGAGGAAGG - Intergenic
1170071595 20:12374965-12374987 AAAGGTTTTGAGCAAGAAGGGGG + Intergenic
1170335507 20:15266654-15266676 AAGTGTGTTAAGCAAGAGAGTGG - Intronic
1170711986 20:18799472-18799494 AAGAGAGTTCAGGAAGAGGGAGG - Intergenic
1170805620 20:19628302-19628324 CAGTGATTTCAGCAAGATGGTGG + Intronic
1172801560 20:37579876-37579898 AAGGGTCTTGAGCAGGAGAGGGG - Intergenic
1173379601 20:42527972-42527994 AAGGATTTTAAACAAGAGAGTGG - Intronic
1173406966 20:42774775-42774797 AAGGGTCTTGAGCAAGAAGAGGG - Intronic
1173916321 20:46710833-46710855 AAGGGTTTTAAGCTGGAGCGGGG + Intronic
1174743648 20:53040450-53040472 AAGGGTTTTGAGCCAAGGGGTGG + Intronic
1175205776 20:57310059-57310081 AAGGGTCTGCAGCAAGAATGTGG - Intergenic
1175851792 20:62097696-62097718 GAGGGTTCCCAGGAAGAGGGTGG + Intergenic
1176649059 21:9529273-9529295 AAGGTTTTGCAGAAAGACGGTGG - Intergenic
1177703790 21:24674223-24674245 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1178340483 21:31782005-31782027 GAGGGTTTTAAGCAAGGGAGTGG - Intergenic
1179958388 21:44753964-44753986 AAAGGTCTTCAGCATGAGGAGGG - Intergenic
1182398460 22:30055245-30055267 GAGGGATGTCAGCAAGAGAGTGG + Intergenic
1182424289 22:30264002-30264024 GCGGGTCTTCAGCAAGTGGGGGG - Exonic
1183681238 22:39330724-39330746 AAGGGATTTGGGCAAGAGGTGGG + Intergenic
1184179027 22:42806710-42806732 AAGGGCTCACAGCTAGAGGGTGG + Intronic
1184767392 22:46578748-46578770 AAGGGTGTGCAGCAGGAAGGAGG - Intronic
1185267583 22:49912353-49912375 CAGGGTTGGCAGCAAGAGGTTGG - Intronic
949348733 3:3101762-3101784 AAGGCTTTTCAGCAAGTGTGCGG - Exonic
952222540 3:31339602-31339624 AAGTTTTTTCAGAAAGTGGGAGG - Intergenic
953365354 3:42340081-42340103 AAAGGTTTTAAGCAAGAGTATGG - Intergenic
953408698 3:42675200-42675222 AAGGGCTGTGGGCAAGAGGGAGG - Intergenic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954716554 3:52529749-52529771 ACGGGTTTTGAGCAAGTGGGAGG - Intronic
954925688 3:54232258-54232280 GGGGGTTTTCAGCTACAGGGAGG + Intronic
955874164 3:63472780-63472802 ATAGGTTTTCAGCAAGGGAGAGG - Intronic
956047162 3:65208286-65208308 AAGGGATTTTAGGAAGAGGGAGG - Intergenic
957210044 3:77247907-77247929 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
961128517 3:124443759-124443781 AAAAGCTTTCAGGAAGAGGGGGG + Intronic
962450701 3:135514133-135514155 AAGTGTTTTCAGAGAGTGGGGGG + Intergenic
963451661 3:145490149-145490171 TAGGCTTTTCAGCTTGAGGGTGG - Intergenic
965608147 3:170516992-170517014 AATGGTTTTCAGCTAGTGTGAGG + Intronic
965887005 3:173458318-173458340 AAGTGTTTTTAGAAAGAGGGAGG + Intronic
967086176 3:186097199-186097221 AAGGGTTTACAGCCATAGTGAGG + Intronic
967627898 3:191707870-191707892 CAGGTTTTTCAGCTTGAGGGTGG - Intergenic
970191822 4:13524879-13524901 AAAGGTTGTCAGCAAGACTGGGG - Intergenic
970280784 4:14452472-14452494 AAGGGGTTGCAGTAAGTGGGTGG + Intergenic
970559697 4:17270466-17270488 ATGGGTTTTCAGACAGAGCGAGG - Intergenic
971534233 4:27728276-27728298 ATGGGCTTTAAGCAAGAGGTAGG - Intergenic
971560006 4:28066617-28066639 TGGGGTGATCAGCAAGAGGGCGG + Intergenic
972066492 4:34952867-34952889 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
975613477 4:76223525-76223547 AAGGGATTAGAGGAAGAGGGCGG - Intronic
977863904 4:102000504-102000526 AAAGATCTTCAGTAAGAGGGTGG + Intronic
978937873 4:114399851-114399873 CAGGCTTTTCGGCAAGAGGATGG + Intergenic
981434698 4:144706806-144706828 TGGAGTTTTCAGCAAGATGGAGG - Intronic
982862034 4:160464097-160464119 CAGGATTTTCAGCTTGAGGGTGG + Intergenic
983424826 4:167569892-167569914 AAGGGTTTTCAACACGTGAGTGG - Intergenic
984292115 4:177808480-177808502 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
985023030 4:185712082-185712104 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
988350869 5:30106066-30106088 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
990528922 5:56654864-56654886 AAGGGTTTTAAGCAAGGGAGTGG - Intergenic
993308308 5:86296658-86296680 AAGCGTTTTCAGCAAGAACATGG - Intergenic
994802249 5:104393794-104393816 GAAGGTTTTCAGCAAGAAAGGGG + Intergenic
995015456 5:107304265-107304287 AGGGGTTTTGATAAAGAGGGAGG - Intergenic
998135543 5:139672520-139672542 AAGGGTTTTGAGCAGGACGCAGG - Intronic
998707721 5:144782929-144782951 AAGGGTTTGCAGCAGGAGGTGGG + Intergenic
999200997 5:149816168-149816190 AATGGTTTTTAGCTAGAGAGTGG + Intronic
999325384 5:150640519-150640541 GAGGGTTTTGAGCAGGAGAGAGG + Intronic
999491493 5:152055802-152055824 AAGGGTTTTGAGCAAAAGTTTGG + Intergenic
1001116372 5:168944201-168944223 AAGGGTTGTCAGCGATAGGAGGG - Intronic
1003188940 6:3856022-3856044 GAGGATTTTCAGCAAGGAGGAGG + Intergenic
1004211634 6:13651988-13652010 AAGAGTTTTCAGGCAGAGGGAGG - Intronic
1006097419 6:31664798-31664820 AAGTGGTTTCAGAAAGAGGCTGG - Intronic
1007968889 6:46030521-46030543 AAGGGTTTTGAGCAAGGGCGGGG - Intronic
1008460601 6:51765358-51765380 AAGGGTTTTATGCAGGAGGATGG - Intronic
1009902649 6:69827743-69827765 AGGGGATTCCAGAAAGAGGGAGG + Intergenic
1009948247 6:70364758-70364780 CAGGCTTTTCAGCTGGAGGGTGG + Intergenic
1010186277 6:73146838-73146860 AAGTGTTTGTAGCAAAAGGGAGG - Intronic
1011362903 6:86547677-86547699 AAGAGTTTAATGCAAGAGGGAGG + Intergenic
1011728577 6:90236051-90236073 AACAGATTTCAGCAAGAGTGAGG - Intronic
1012378606 6:98591968-98591990 AAGGGTTTTAAGCAAAAGATTGG + Intergenic
1012517039 6:100073611-100073633 AAGTGATATCAGCAAGATGGTGG - Intergenic
1013308605 6:108872734-108872756 AAGGGTTTTCAGCAAGAGGGTGG - Intronic
1013516250 6:110888910-110888932 CAGTGCTTTCAGCAAGAGGGTGG - Exonic
1014136456 6:117895424-117895446 AAGAGTTTTAAGCAGGAGGGTGG + Intergenic
1015750415 6:136553036-136553058 AAGGTTTTTGAGCAAGGGAGAGG - Intergenic
1016183163 6:141171497-141171519 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1017800645 6:157892705-157892727 AAGGATTTTCATCAAGATGGAGG - Intronic
1018124299 6:160667226-160667248 GAGGGTTGGAAGCAAGAGGGGGG - Intergenic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018395313 6:163373832-163373854 AAGGGTTTGGAGCAAGGGGCTGG + Intergenic
1018616348 6:165690518-165690540 CAGGGTTTTGAGCAAGGGAGGGG - Intronic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1021956495 7:25830296-25830318 AAGGGTTTTCAGCAATACAAAGG + Intergenic
1022874199 7:34511931-34511953 AGGGGTCTTCACCAAGAGGGAGG + Intergenic
1022993624 7:35731957-35731979 AAGGGTTTTGAGCACAAGGGTGG + Intergenic
1023215995 7:37863490-37863512 AAGGGTTTTCTGTACGTGGGCGG + Intronic
1023988760 7:45115101-45115123 ATGATTATTCAGCAAGAGGGAGG + Intergenic
1024063098 7:45713512-45713534 AAGTGATTTCAGCAAGAGTAGGG + Intronic
1024554481 7:50591775-50591797 GGGGGTTTTCAGCAGGACGGAGG + Exonic
1025275597 7:57579343-57579365 AAGGTTTTGCAGAAAGACGGTGG - Intergenic
1028608531 7:92682189-92682211 AAGGATTTTAAGCAGGAGAGTGG - Intronic
1029969661 7:104776878-104776900 AAGGGTTTTCAGCCACAAGTAGG - Intronic
1031063467 7:117077318-117077340 CAGGTTTTTCAGCTGGAGGGTGG + Intronic
1032101710 7:128984979-128985001 TGGGGATTGCAGCAAGAGGGAGG - Intronic
1032824816 7:135558449-135558471 AAAGGTGGTCAGGAAGAGGGTGG + Intronic
1032906392 7:136372449-136372471 AAGGGTTTTCAGCAGAGGAGTGG - Intergenic
1036404478 8:8442438-8442460 ACAGGTTTTCAGCAAGAGAGCGG + Intergenic
1036658440 8:10692368-10692390 AAGGGTTTCCAGCAGGTAGGGGG - Intronic
1037184045 8:16040231-16040253 AAGGTTTTTCTGTAAAAGGGAGG - Intergenic
1037701023 8:21273899-21273921 ATGGGTTTTCAGCTGGAGGAGGG + Intergenic
1038059407 8:23895907-23895929 GAGAGTTTTGAGCAAGATGGTGG - Intergenic
1040664250 8:49613023-49613045 TAGGGATTTCAGCAAGAGTGTGG + Intergenic
1040667023 8:49646170-49646192 CAAGGTTTTCAGAGAGAGGGTGG - Intergenic
1043329647 8:79099452-79099474 AGTTGTTTTCAGCAAGAAGGAGG + Intergenic
1043529633 8:81135203-81135225 GAGGGTTTTCTGCAGGAGAGTGG - Intergenic
1044510306 8:93069611-93069633 CAGAGTTTTCAGTCAGAGGGAGG - Intergenic
1044523553 8:93226280-93226302 AAGAGAATTCAGCAAGAGGAGGG + Intergenic
1044733395 8:95251543-95251565 AAGGGTGTTGAGCAGGAGGACGG + Intronic
1045010563 8:97955225-97955247 AAGGGTTTTAAGCAGAAGAGAGG + Intronic
1046286299 8:112096705-112096727 AAGCGTTTTCAGCAACAATGAGG - Intergenic
1047395182 8:124491190-124491212 AAGGATTTTAAGCAGGAGAGTGG - Intronic
1047712025 8:127561982-127562004 AGGTGTTTTCAGCAAGGGAGAGG + Intergenic
1047835006 8:128679905-128679927 AAGGGTGTCCAGGGAGAGGGAGG - Intergenic
1049378777 8:142301784-142301806 CAGGGTTTTCAGGAAGATCGGGG - Intronic
1050841884 9:10159904-10159926 AAGGGATTTGAGCAAGAATGAGG + Intronic
1051110384 9:13628291-13628313 AAGGGTTCTTAGCCAGATGGAGG + Intergenic
1051797865 9:20894488-20894510 AAGGCTTTGGAGCAAGAGGAAGG - Intronic
1053352934 9:37425142-37425164 AGGGGTTCACAGCAGGAGGGAGG - Intronic
1053383796 9:37670684-37670706 AAGGGTTTTGAATAAGGGGGAGG + Intronic
1053447099 9:38161178-38161200 ATGGGGTTTCAGCAACAGGAAGG - Intergenic
1053653992 9:40197262-40197284 AAGGTTTTGCAGAAAGACGGTGG + Intergenic
1053904381 9:42826437-42826459 AAGGTTTTGCAGAAAGACGGTGG + Intergenic
1054366110 9:64343478-64343500 AAGGTTTTGCAGAAAGACGGTGG + Intergenic
1054530604 9:66179077-66179099 AAGGTTTTGCAGAAAGACGGTGG - Intergenic
1054673738 9:67833208-67833230 AAGGTTTTGCAGAAAGACGGTGG + Intergenic
1057379541 9:94555495-94555517 AAGGTTTTGCAGAAAGACGGTGG + Intergenic
1059083559 9:111275495-111275517 GAGGGATTTCAGACAGAGGGAGG - Intergenic
1059235293 9:112755520-112755542 CAGGGTCTTGAGCAGGAGGGGGG + Intronic
1060072575 9:120563197-120563219 AAGGGTGTCCAGGCAGAGGGTGG + Intronic
1203626795 Un_KI270750v1:32822-32844 AAGGTTTTGCAGAAAGACGGTGG - Intergenic
1185853797 X:3513418-3513440 AAGGATTTTGAGCATGAGAGAGG + Intergenic
1186461901 X:9754582-9754604 AAGGGTCTTCAGCCAGTGGGGGG - Intronic
1186570544 X:10710674-10710696 AATGTTTGTCAGCAAGAGGGAGG - Intronic
1190212577 X:48459954-48459976 CAGGGATCTCAGCCAGAGGGTGG - Intronic
1190280861 X:48928917-48928939 TAGTGTTTGCAGGAAGAGGGAGG + Intronic
1191706601 X:64100558-64100580 AAGTTTCTTCAGAAAGAGGGTGG + Intergenic
1194788080 X:98111517-98111539 CAGGGGTTTTAGCAAGAGGGAGG - Intergenic
1194966501 X:100294439-100294461 AAGGGTTTTGAGGGAGGGGGTGG - Exonic
1194997409 X:100606272-100606294 AAGGGGGTTCAGAAAGAGAGAGG + Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1199606133 X:149581122-149581144 AAGGGTTTCCTGCAAGATGAGGG - Intergenic
1199632988 X:149788246-149788268 AAGGGTTTCCTGCAAGATGAGGG + Intergenic
1199780210 X:151051547-151051569 AAGGGTTTTACGCAGGAGAGTGG + Intergenic
1200380219 X:155829304-155829326 CAGTGCTTTCAGCAAGAGGGTGG + Intergenic
1200809660 Y:7471106-7471128 AAGGATTTTGAGCATGAGAGAGG - Intergenic