ID: 1013312833

View in Genome Browser
Species Human (GRCh38)
Location 6:108913475-108913497
Sequence GAAGTCTTCCTAGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013312833 Original CRISPR GAAGTCTTCCTAGCCAAAAC AGG (reversed) Intronic
901098716 1:6702633-6702655 GAAGCCTTCCTGCCCAGAACAGG + Intergenic
905463960 1:38139078-38139100 GAAGTCTTCCGAGGGAAAGCTGG + Intergenic
905753041 1:40482742-40482764 GGAGTATTCCTAGGCAAAAAGGG + Intronic
908279247 1:62513234-62513256 GAAGACTTTCTAGAGAAAACGGG + Intronic
909872656 1:80762858-80762880 GAAGTTGACCTAGCCAAAATAGG + Intergenic
912109780 1:106327389-106327411 GATGTCCTCCTATACAAAACGGG + Intergenic
912701878 1:111884135-111884157 CCAGTCCTCCTAGCCAAAAATGG - Intronic
916579580 1:166095505-166095527 GTACTCTTCCTAGCCAATGCTGG + Intronic
917520637 1:175745647-175745669 GAAGTCTTCCCAGCAAAAAGTGG + Intergenic
921651345 1:217681995-217682017 GAAGACTTCATATCCAAAAAGGG + Intronic
1064745369 10:18473278-18473300 GAAATACTCCTATCCAAAACAGG - Intronic
1066705269 10:38170961-38170983 GTAGTCATCCTAGCTAAAGCAGG + Intergenic
1068572497 10:58645519-58645541 GAAGTCTGCCTAGCAACTACTGG - Intronic
1072795763 10:98353335-98353357 GAAGTCTTCCAAGCACAAAGAGG + Intergenic
1074325301 10:112445432-112445454 GCATTCTTCCTTGCCAAAATGGG - Exonic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078216106 11:9313357-9313379 GAAGTTCTCCTAGCCATCACTGG + Intronic
1091725768 12:2845542-2845564 GAAGTCTTCCCAGCCATTTCCGG - Intronic
1092872853 12:12821782-12821804 AAAGTCTTTCTATCCAACACTGG - Intronic
1099646932 12:85369153-85369175 GAAGGCTTCCTAGACAAAATGGG - Intergenic
1100166344 12:91922208-91922230 GAAATTTTCCCAGCCAACACTGG + Intergenic
1101867277 12:108529546-108529568 GAACTCTTGCTAGCCAAACCTGG + Intronic
1110790767 13:79584347-79584369 CAAGTTTTCCTACCCAATACTGG - Intergenic
1112137712 13:96600998-96601020 GAAACCTTCCAAGCCAAAAGGGG - Intronic
1114598011 14:23930785-23930807 GAAGGGTTCCTAGCCAAAGGCGG + Intergenic
1116623156 14:47232047-47232069 GAAGACTTTCTAGTCAAAAGTGG - Intronic
1118442287 14:65822721-65822743 GAAGTCATCATAGCCAAAATAGG - Intergenic
1118693270 14:68360314-68360336 GAAGTCCTCCTGGCCATAAAAGG + Intronic
1121140301 14:91535994-91536016 AAAGTCTTCCTAGCTCAAAAAGG - Intergenic
1125096797 15:35864183-35864205 GAAGTGTTCCTGGGAAAAACTGG + Intergenic
1126275914 15:46880731-46880753 GAAGTCTTTCTAGGTAAAACAGG - Intergenic
1128288375 15:66457600-66457622 AAAATCTTCCTAACCAAAAGGGG + Intronic
1128586336 15:68853573-68853595 GGACTCTTACTAGCCAAATCAGG + Intronic
1128717576 15:69919911-69919933 GCTGTCCTCCCAGCCAAAACTGG + Intergenic
1132309029 15:100842824-100842846 GAATTCCTCCTAGCCAGAGCAGG - Intergenic
1138509726 16:57501467-57501489 GAAGCCTTCCCAGACAAATCAGG - Intergenic
1146280121 17:31539275-31539297 GTATTCTTACTAGCCAAATCTGG - Intergenic
1146708874 17:35023370-35023392 TAAGTCTTAATAGCCAAAACTGG - Intronic
1147908457 17:43839383-43839405 GAAGAATTCTTAGCCAAAATAGG + Intergenic
1149294285 17:55247818-55247840 GAAATGTGCCTAGCTAAAACGGG - Intergenic
1150341050 17:64367716-64367738 GAATTCTTCATAGGTAAAACCGG + Intronic
1152595699 17:81236617-81236639 GAAGTCTTCCTTCTCAAACCTGG + Intronic
1153248114 18:3093607-3093629 GGAGTCTTTCCAGCAAAAACCGG - Intronic
1153372329 18:4333444-4333466 TAGGTCTTCCTATCCAAAAGTGG - Intronic
1156442444 18:37205140-37205162 AAAGTCTCACTAGCCAAAAATGG + Intronic
1161084232 19:2326907-2326929 CAAGTGTCCCTAGCCAACACTGG + Intronic
1166359497 19:42247205-42247227 GAAGAATTCCTAGCCACAAGTGG + Intronic
926368688 2:12158055-12158077 TTATTCTTCATAGCCAAAACTGG - Intergenic
927234923 2:20863841-20863863 GAAGTCTTCCTCTTGAAAACTGG + Intergenic
927286623 2:21363469-21363491 GTAGAATTCCTATCCAAAACTGG - Intergenic
929946569 2:46376789-46376811 GAACTCTTCCCAGCCCCAACGGG - Intronic
931617055 2:64170084-64170106 GAAGTCTTCCTAGATGAGACAGG + Intergenic
939042502 2:137207964-137207986 GAAGTGTTCCCAGACCAAACAGG + Intronic
941217845 2:162736203-162736225 GAAGTTTTCTTAGTCCAAACAGG - Intronic
945077553 2:206055322-206055344 GAAGTTTTCTTAAGCAAAACAGG + Intronic
945615977 2:212067526-212067548 GAAGTCCTACAGGCCAAAACTGG + Intronic
947806038 2:232968771-232968793 GATATCTTATTAGCCAAAACTGG - Intronic
1169473829 20:5911877-5911899 GAGGGCTTCCTAGCCCAACCAGG + Intronic
1169927920 20:10802360-10802382 GAAGTCTTCCGAGGGAAAAATGG - Intergenic
1182483717 22:30626730-30626752 GAAGTCTTTCTGGCCAAGTCTGG + Exonic
954176053 3:48847007-48847029 GTTGTCTTCGAAGCCAAAACTGG + Intronic
954390962 3:50267725-50267747 GAGGTCTTCCAGGCCAACACTGG - Intronic
960085626 3:113587948-113587970 GAACTCATCCAAGGCAAAACTGG - Intronic
962278382 3:134032151-134032173 TAAGTCTTCTTGGCCAAACCTGG + Intronic
964747545 3:160026448-160026470 GGGGTCTTTCTAGCCCAAACTGG - Intronic
968166408 3:196468995-196469017 GAAGTCTTCCTGACTAAAATTGG - Exonic
971350084 4:25847833-25847855 GAAGTCTGCCTACCCAAAGATGG + Exonic
972708228 4:41566890-41566912 GAAGTCTTTCAAGCCTAGACTGG + Intronic
973114048 4:46432573-46432595 CATGTCTTACTAGCTAAAACTGG - Intronic
975269805 4:72418529-72418551 CCAGTATTCCTAGTCAAAACAGG + Intronic
977419060 4:96774343-96774365 GAAGCCTACCTGGGCAAAACAGG - Intergenic
977639709 4:99343185-99343207 GAAGCATTTCAAGCCAAAACAGG - Intronic
979572554 4:122245806-122245828 AAAATATTCCTAGCCAAAAAGGG + Intronic
980841212 4:138263908-138263930 GAAGACTTCAAAGCAAAAACTGG - Intergenic
981296109 4:143133711-143133733 GTAGTCTTCATAGAGAAAACAGG + Intergenic
994159539 5:96541257-96541279 GAACTCTTAGTAGCCAAAGCTGG - Intronic
999182756 5:149681472-149681494 GCAGTATTCCTACCCATAACTGG + Intergenic
1001356167 5:171025492-171025514 GAAGGCTGCCTAGAGAAAACAGG - Intronic
1005447007 6:25934309-25934331 GAAGGCTTCCCAGGCAGAACAGG + Intergenic
1008373096 6:50758861-50758883 GAGATCTTCCTTGCTAAAACTGG + Intronic
1012463803 6:99494428-99494450 CAAGTCTTCAAAGACAAAACTGG + Intronic
1013312833 6:108913475-108913497 GAAGTCTTCCTAGCCAAAACAGG - Intronic
1013914126 6:115313758-115313780 AAAGTCTTCCTAACCTAAAAGGG + Intergenic
1017039760 6:150298464-150298486 GATGTCTTCCCAACCAAGACTGG + Intergenic
1017598763 6:156058838-156058860 GAAGTCTTCCTAGACACTAATGG - Intergenic
1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG + Intronic
1022964482 7:35459720-35459742 GAAGTCTCACCAGCCAGAACTGG + Intergenic
1024115230 7:46186581-46186603 CATGCCTTCCTAGCCTAAACAGG - Intergenic
1031251768 7:119391521-119391543 GAAGTTTTCCTAGGCAAGTCTGG + Intergenic
1032184435 7:129712030-129712052 GAATTCTTCCTTACCAAAATTGG + Intronic
1032750989 7:134841588-134841610 GAAGTCTACCTAGCAAAAAAGGG + Intronic
1032915515 7:136484627-136484649 GGAGTCTCCTTAGCCAAAAGGGG + Intergenic
1032985296 7:137330686-137330708 GAAGAGTTCCTTCCCAAAACAGG - Intronic
1035465727 7:159075422-159075444 GGAGACTTCAAAGCCAAAACTGG - Intronic
1037252958 8:16918673-16918695 GAAGTCATCCTATCTCAAACAGG + Intergenic
1041977289 8:63814561-63814583 TAAATCTTCATAGACAAAACAGG + Intergenic
1042876970 8:73448958-73448980 GAAGTCTTCCCAGCCCCAGCCGG - Intronic
1051012005 9:12428232-12428254 GAAGCCTTAGTAACCAAAACAGG + Intergenic
1054841089 9:69740936-69740958 GAAGACTACCTAGCAAAAAATGG - Intronic
1055062950 9:72089869-72089891 TAAGTCTTCTTAGACAATACAGG + Intergenic
1059605558 9:115831151-115831173 GAAGTCCTCCTCACCAAGACAGG + Intergenic
1061109578 9:128559115-128559137 GAGGTCTGCCAAGCCACAACAGG - Intronic
1185820361 X:3197252-3197274 GAACTCTTTCTAGACAAAGCAGG + Intergenic
1187840896 X:23486407-23486429 CAAGTCTTCCCTGCCACAACAGG + Intergenic
1196594214 X:117524368-117524390 GAAGTCTTCCCACCCTAAAATGG + Intergenic
1196905424 X:120427476-120427498 GATGCCTGCCTAGCCAAAGCTGG - Intergenic
1201639731 Y:16166185-16166207 GAAGTGTTCCTTTCCAAAATAGG + Intergenic
1201663082 Y:16419140-16419162 GAAGTGTTCCTTTCCAAAATAGG - Intergenic