ID: 1013313032

View in Genome Browser
Species Human (GRCh38)
Location 6:108915340-108915362
Sequence CTCGTCATGTTCTCTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013313032_1013313036 -2 Left 1013313032 6:108915340-108915362 CCAGCCAGAGAGAACATGACGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1013313036 6:108915361-108915383 AGGGCCAAAAAGATACAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1013313032_1013313038 11 Left 1013313032 6:108915340-108915362 CCAGCCAGAGAGAACATGACGAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1013313038 6:108915374-108915396 TACAAGCAGGCAACATCTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013313032 Original CRISPR CTCGTCATGTTCTCTCTGGC TGG (reversed) Intronic
900275026 1:1819736-1819758 CTCGTCATGTTGCCTGTGGCTGG + Intronic
905286187 1:36881943-36881965 CACGTGCTGTCCTCTCTGGCTGG + Intronic
907364933 1:53950242-53950264 CTCGTTCTGTTCCCTTTGGCTGG - Intronic
908808718 1:67957601-67957623 CTGGTCTTGTCCTCTCTGGGTGG + Intergenic
916974235 1:170058379-170058401 CTCTCCATATGCTCTCTGGCAGG + Intronic
917601379 1:176577693-176577715 CCCCTCATGCTCTCTCTGGGGGG + Intronic
924250964 1:242132786-242132808 TTAGTCATGTTCCTTCTGGCAGG - Intronic
924680273 1:246224095-246224117 CCAGTCTTGTTCTCTCTGGTAGG - Intronic
1070230228 10:74558361-74558383 CTCATCATTTTCTATCTGGTGGG + Intronic
1072334259 10:94383595-94383617 AAGGTCAAGTTCTCTCTGGCAGG - Intergenic
1074860444 10:117506069-117506091 CTCCTCATTCTCTCACTGGCTGG + Intergenic
1075942889 10:126406306-126406328 CTCTTCCTGTTCACTCTGGCCGG + Intergenic
1076088191 10:127654381-127654403 CCAGTCATATTCTCTGTGGCTGG + Intergenic
1076750876 10:132542296-132542318 CTCGGCAAGTGCTCGCTGGCAGG + Intronic
1079033122 11:17000400-17000422 CTGTTCATCTTCTCTCTGGTTGG + Intronic
1080798069 11:35583954-35583976 CTTTTCCTCTTCTCTCTGGCTGG - Intergenic
1083764611 11:64835934-64835956 CTCCTCATGTCCACTGTGGCTGG - Intronic
1083855671 11:65391980-65392002 GTCCTCATGCTCTCTCTGTCTGG - Intronic
1086599800 11:88618909-88618931 CTTGCCAGGTGCTCTCTGGCTGG + Intronic
1091432573 12:449014-449036 CTAGGCATTTTCTCCCTGGCAGG - Intergenic
1096591430 12:52662489-52662511 CTCGTCTTGTGATCTCAGGCAGG - Intergenic
1098140672 12:67447426-67447448 CTTGTCATGATCTCTCTTCCAGG + Intergenic
1098234774 12:68407935-68407957 ATCCTGATTTTCTCTCTGGCTGG + Intergenic
1101538232 12:105640357-105640379 CTCGTCAAGTTCGCTCATGCAGG + Intergenic
1110485294 13:76033947-76033969 CTCGTGTTGTTTTATCTGGCTGG - Intergenic
1111634594 13:90887708-90887730 CACATCATGTTCTCTGTGTCAGG - Intergenic
1118439283 14:65798434-65798456 CTGGCCAGGTTCTCTTTGGCAGG + Intergenic
1119777516 14:77258107-77258129 CTTCTCATGTCCTCCCTGGCTGG - Exonic
1120676881 14:87431010-87431032 CTAGCCATGTTGTCTCAGGCAGG + Intergenic
1124961504 15:34400151-34400173 CTCGTCATGTCCTCTTTGGGAGG - Intronic
1124978130 15:34546374-34546396 CTCGTCATGTCCTCTTTGGGAGG - Intronic
1125983079 15:44021531-44021553 CTTTTCATGTGCTCACTGGCTGG - Intronic
1127660680 15:61097491-61097513 CTTGTCATCTTCCCTCTGCCTGG + Intronic
1128648985 15:69396781-69396803 CCTGTCATGTTCTGTCTGGGGGG + Intronic
1129283692 15:74506383-74506405 CTCTTCCTGTTCTCTTTGGCAGG - Intergenic
1130266551 15:82410061-82410083 CTTGTCATGTCCTCTTTGGGAGG + Intergenic
1130427237 15:83813635-83813657 CTCCTCAGGTTCACTCTGTCAGG + Intronic
1130505477 15:84536824-84536846 CTTGTCATGTCCTCTTTGGGAGG - Intergenic
1131623602 15:94094231-94094253 CTCTTCACCTTCTATCTGGCAGG + Intergenic
1132076146 15:98822307-98822329 CTCTTTGTGTTGTCTCTGGCAGG + Intronic
1133340181 16:5030837-5030859 CACTTCCTGTTCCCTCTGGCTGG + Intronic
1133523873 16:6584880-6584902 CTGGTCATGTTCTCTCTTCCTGG + Intronic
1134377085 16:13687027-13687049 CTCTTGCTGTTCTCTCTGGCTGG + Intergenic
1139248073 16:65467422-65467444 CTTGTCTTGTTTTCTTTGGCTGG - Intergenic
1142859647 17:2753576-2753598 GGACTCATGTTCTCTCTGGCAGG - Intergenic
1143322130 17:6075268-6075290 CTCTGCCTGTTCTCTCTGACCGG + Intronic
1143449174 17:7025491-7025513 CTTGTCAGGGCCTCTCTGGCAGG + Intronic
1145901021 17:28490609-28490631 CTCGTCAGGTTCTCCCGTGCTGG - Intronic
1148406105 17:47417830-47417852 CCTTTCATGTTCTCTCTGTCAGG + Intronic
1151056159 17:71033591-71033613 CTGGTCCTGTTCTTTCTGCCTGG + Intergenic
1154985864 18:21550195-21550217 CTCTTCTTGTTCTCTGTTGCAGG - Intronic
1155177700 18:23315255-23315277 CTCAGCAAGTTCTCTCTGCCTGG + Intronic
1156288864 18:35727055-35727077 TTCTTCATCATCTCTCTGGCAGG - Intergenic
1159605696 18:70472265-70472287 CTCATACTGTTCTCTCTGCCAGG - Intergenic
1160450346 18:78959374-78959396 ATCGTCATCTTCTCCCTGGTGGG + Intergenic
1163416131 19:17187500-17187522 CTGGGCTTGTTCTCTGTGGCAGG - Intronic
1165784506 19:38453171-38453193 CCCATCGTGTTCTCACTGGCTGG - Intronic
1165819877 19:38667835-38667857 CTTGTCATTTTTCCTCTGGCTGG + Intronic
1166732605 19:45067533-45067555 CTGGTCAGCTTCTCTCTTGCGGG - Exonic
926259979 2:11250934-11250956 CTCTGCATGTTCCCTCTGCCTGG + Intronic
926644732 2:15277307-15277329 CTCGTCATGTTATCTCACGGGGG + Intronic
927059094 2:19397408-19397430 CTCTTTGTGTTCTCTTTGGCTGG - Intergenic
927082324 2:19642732-19642754 CTCCCCATGTTCTGACTGGCAGG + Intergenic
928072023 2:28226733-28226755 CTCCTGCTGTTCTCTCTGCCTGG - Intronic
931257205 2:60584106-60584128 CTGGTCATGTTCTTGCTGCCCGG - Intergenic
936524454 2:113233354-113233376 CTCTACATTTTCTTTCTGGCTGG - Intronic
936625376 2:114142673-114142695 CTGGCCTTGTTCTCTCAGGCTGG + Intergenic
936682246 2:114787239-114787261 CACTTGATGTTCTCTCTGCCAGG - Intronic
938638491 2:133254279-133254301 CTCCACATGCTCTCTCTAGCAGG - Intronic
940277539 2:151955222-151955244 CTCGTCATTTCCTCACTGGTTGG + Intronic
945793897 2:214337952-214337974 CTAGTCATGTCCTTTCTAGCAGG - Intronic
947527968 2:230890948-230890970 TTAGAAATGTTCTCTCTGGCTGG + Intergenic
947666449 2:231908966-231908988 CACTTGATGTTCTCTCTGCCTGG - Intergenic
1170033728 20:11968834-11968856 CTCTTGCTGTTCTCTCTGTCTGG - Intergenic
1171933893 20:31255414-31255436 CTCTTGCTGTTCTCTCTGCCTGG + Intergenic
1176366170 21:6034166-6034188 CTGGGCCTGTTCTCTCTGGAAGG + Intergenic
1177079378 21:16619738-16619760 CTCTTCATGCTTTCTCTGCCTGG - Intergenic
1179757347 21:43504379-43504401 CTGGGCCTGTTCTCTCTGGAAGG - Intergenic
950972807 3:17205806-17205828 CTCATCGTGTTCTCTCAAGCGGG - Intronic
959149673 3:102593180-102593202 CTCATGTTGTTCTCTCTGCCTGG + Intergenic
960242321 3:115359832-115359854 CTCCTCATTTTGTTTCTGGCTGG + Intergenic
961378408 3:126482024-126482046 CTGGTCAAGCTCTCTCCGGCTGG - Exonic
962728344 3:138256349-138256371 TTTGTCATTTTCTCTCTGGGAGG + Intronic
966447645 3:180021191-180021213 CTAGTGATGTTCTCTCTGACCGG - Intronic
969611588 4:8230330-8230352 CTCGTCATGTTCCCCCAGGCTGG + Intronic
969942091 4:10742883-10742905 CTAGTCCTATTCTCTCTGACAGG - Intergenic
970387382 4:15569271-15569293 CTGGTCATGTGCTGTCTTGCAGG + Exonic
971852511 4:32001172-32001194 CTCTAAATGTTTTCTCTGGCAGG - Intergenic
973270089 4:48253982-48254004 CTCGAGTTGTTCTCTCTGGAAGG + Intronic
973721016 4:53723787-53723809 CACCTCTTCTTCTCTCTGGCGGG + Intronic
975626825 4:76358601-76358623 CCCATAATGTTCTCTCTGCCTGG + Intronic
979189569 4:117839747-117839769 CTTGTCATCTTCTCTCTAGATGG + Intergenic
981170478 4:141616932-141616954 TTCGTGATGTTCTCTCTGTCAGG + Intergenic
981392400 4:144206670-144206692 CTGGTTCTGTTCTCTGTGGCTGG - Intergenic
981571665 4:146158120-146158142 TTCGTGATGTTCTCTCTGTTGGG - Intergenic
985903229 5:2813522-2813544 CTCTTCAGGTTCTCACTGCCCGG - Intergenic
986771244 5:10975898-10975920 GTTGTCATGTTCTCTCTGGTTGG + Intronic
988873541 5:35417982-35418004 CTCCTCCTCTTCCCTCTGGCTGG + Intergenic
989215909 5:38904404-38904426 CGCGCCATGTACTCTGTGGCAGG - Exonic
990844955 5:60127114-60127136 CTCATGCTGTTCTCTCTGCCAGG - Intronic
997509943 5:134447181-134447203 CTCCTCCTGTTCTTTCTTGCAGG - Intergenic
999016870 5:148116366-148116388 TTCCTCATTTTCTTTCTGGCTGG - Exonic
1000034317 5:157431775-157431797 TTCTTGATGTTCTCTCTAGCAGG - Intronic
1009657996 6:66570261-66570283 CTGGTGGTGTTATCTCTGGCAGG - Intergenic
1010472509 6:76245395-76245417 CTCATCATGGCCTCTGTGGCAGG + Intergenic
1013313032 6:108915340-108915362 CTCGTCATGTTCTCTCTGGCTGG - Intronic
1015642264 6:135347894-135347916 CTTGTCAGAATCTCTCTGGCTGG - Intronic
1016676294 6:146773021-146773043 CTCATGTTGTGCTCTCTGGCAGG - Intronic
1016748759 6:147609850-147609872 CTAAATATGTTCTCTCTGGCCGG - Intronic
1018970832 6:168527606-168527628 CCCGTCCTGTGCTCTCTCGCAGG + Exonic
1023619063 7:42051103-42051125 CTGGTCATATCTTCTCTGGCAGG + Intronic
1023872842 7:44272081-44272103 CTCTTCATTTTCTTTCCGGCGGG + Intronic
1029452429 7:100648638-100648660 ATCGTCAAGTCCCCTCTGGCAGG - Exonic
1030200001 7:106892851-106892873 CTCGTGCTGTTCTTTCTGTCTGG - Intronic
1031223518 7:119004521-119004543 CTCTTGTTGTTCTCTCTGCCAGG - Intergenic
1032067678 7:128783760-128783782 CTTGTCCTGATCTCTCTGACAGG - Intergenic
1032570146 7:132987245-132987267 TTCATGATGTTCTCTCTGTCCGG - Intronic
1032663191 7:134008575-134008597 CTCTTCTTGTTCTCACTGGGAGG + Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033674296 7:143522564-143522586 TTCTTCATGTTTTCTTTGGCTGG + Intergenic
1033687072 7:143650740-143650762 TTCTTCATGTTTTCTTTGGCTGG + Intronic
1033697539 7:143806883-143806905 TTCTTCATGTTTTCTTTGGCTGG - Intergenic
1034407616 7:150915761-150915783 GTGGTCATGTTTTCTCTAGCTGG - Intergenic
1036822057 8:11949008-11949030 CTTTTCTTGTTCTCTCTGACTGG + Intergenic
1041172051 8:55153456-55153478 CTCCTCTTCTTTTCTCTGGCAGG - Intronic
1050113416 9:2240105-2240127 CTCGCCATATTCCCTCTGTCTGG + Intergenic
1053216534 9:36275338-36275360 CACATCATGTTCTCTCTTCCAGG - Intronic
1057392607 9:94652244-94652266 TTCTTCATGGACTCTCTGGCTGG + Intergenic
1057505266 9:95628154-95628176 CTGGTCCTGTTCACTCTGGCCGG + Intergenic
1057719020 9:97517666-97517688 CTTCTCACGTTCTCCCTGGCTGG - Intronic
1058637213 9:107048455-107048477 CACATGCTGTTCTCTCTGGCAGG + Intergenic
1059824280 9:118009669-118009691 GTGGTCATGAGCTCTCTGGCTGG - Intergenic
1059899536 9:118907759-118907781 CTCATCATGTGCTCTTTGGGAGG + Intergenic
1060489246 9:124070079-124070101 CTCAACACGTTCTCTCTGCCTGG + Intergenic
1061924400 9:133798881-133798903 CTGGTGATATGCTCTCTGGCAGG + Intronic
1187495366 X:19790510-19790532 CTGGTCCTCTTCACTCTGGCTGG - Intronic
1190772231 X:53524763-53524785 TTCGTGATGTTCCCTCTGTCAGG - Intergenic
1190781246 X:53597836-53597858 TTCGTGATGTTCCCTCTGTCAGG - Intronic
1192135808 X:68599247-68599269 CTCACCATGTTCTCTCTCCCTGG + Intergenic
1197125860 X:122945401-122945423 GTTGTCATGTTCTCTGAGGCTGG - Intergenic
1197835952 X:130693914-130693936 CTCCACATGGTCTCTCTAGCAGG - Intronic
1199159453 X:144591153-144591175 CTCTTGATGTTCTCTCCGACTGG - Intergenic
1199275363 X:145935959-145935981 CTCATCATCTTCACTCTGGGCGG + Intergenic
1199605199 X:149572390-149572412 CAGGTCATGTTCTCTCTCACAGG + Intergenic
1202364477 Y:24147798-24147820 CTTGTCATGTCCTCTTTGGGAGG + Intergenic
1202506304 Y:25522324-25522346 CTTGTCATGTCCTCTTTGGGAGG - Intergenic