ID: 1013314426

View in Genome Browser
Species Human (GRCh38)
Location 6:108927431-108927453
Sequence TGCAGTGTGCTCCTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013314426 Original CRISPR TGCAGTGTGCTCCTTCCTTG TGG (reversed) Intronic
900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG + Intergenic
900596299 1:3481659-3481681 TGCTGGGTGCTCCCTCCCTGAGG - Intergenic
900640886 1:3687608-3687630 TCCTGTGTCCTCCCTCCTTGTGG - Intronic
900801727 1:4741229-4741251 TGGTCTGTGGTCCTTCCTTGCGG - Intronic
901814208 1:11784781-11784803 TGCTGTGTGTCCCCTCCTTGGGG + Intronic
902007176 1:13241641-13241663 TGCAGTGTGCTCGGATCTTGTGG - Intergenic
904678967 1:32215702-32215724 TCCAGTTTCTTCCTTCCTTGGGG + Intronic
905402471 1:37713736-37713758 AGCAGGGTGCACCTTTCTTGTGG - Intergenic
906721386 1:48007623-48007645 TTCAGTGTTTTCCTTCTTTGTGG + Intergenic
907661985 1:56401732-56401754 TGCTGTGTGCCCCTTCTTTGTGG - Intergenic
910561711 1:88598543-88598565 TGTAGTGGGGTCCTTCCTTAAGG - Intergenic
911796516 1:102083390-102083412 TGCAGTGTGCACATTCAGTGTGG - Intergenic
912062515 1:105690188-105690210 TGCAGTGTGGTCCGTGCTTCTGG - Intergenic
918774301 1:188609307-188609329 TATAGTGGGGTCCTTCCTTGGGG - Intergenic
920959853 1:210654730-210654752 TGCACTGTACTCATTCCATGGGG - Intronic
922844105 1:228669247-228669269 TGCAGTGTGGTTCTTACTGGTGG + Intergenic
1063718955 10:8558994-8559016 TGCAGGATGATTCTTCCTTGGGG - Intergenic
1063885789 10:10577117-10577139 TGCAGTTTGCTTCTTGCTTCAGG - Intergenic
1064337082 10:14453414-14453436 TGCAGTCTGCTCTCTCCTTGTGG - Intronic
1067041302 10:42954586-42954608 TGCAGTGTGCTCCATGCTCTCGG + Intergenic
1067422147 10:46161179-46161201 TGGAGTGTGCTCCTTACCCGGGG - Intergenic
1069634930 10:69919225-69919247 TGCAGTGTGCTCCTGACCAGTGG - Intronic
1070082342 10:73201290-73201312 TGCATTGTGCTTCTTTCTTTGGG + Intronic
1070224239 10:74483755-74483777 AGCATTGTGCTCCTTCTTTAGGG - Intronic
1072189903 10:93070589-93070611 TGCTGTGTCCCCCTTCCTTCTGG - Intergenic
1072693439 10:97586435-97586457 GGGAATGTGCCCCTTCCTTGGGG + Intronic
1073401654 10:103262373-103262395 TCCAGTCTGCTTCTACCTTGAGG + Intergenic
1074091358 10:110261045-110261067 AGCAGTGTGCTCTTTCCTCCTGG - Intronic
1076485204 10:130811255-130811277 AGCAGGGGGCTCCTTCCCTGAGG + Intergenic
1077669282 11:4143057-4143079 TGCAGTGGGATCCTTCCTCAAGG - Intergenic
1078335971 11:10463418-10463440 AGCAGTGTGCTCATCCCTGGAGG + Intronic
1080070451 11:28077822-28077844 TGCAGTGTGCTTCCTCCTAAGGG + Intronic
1080448540 11:32359386-32359408 TGGAGTGTAATCCTTCATTGAGG + Intergenic
1081926671 11:46835313-46835335 TGCCGTCTGCTCCTTGCTAGTGG - Intronic
1082900284 11:58241956-58241978 TGCATTGTGCTTCTTTCTTTGGG - Intergenic
1083833450 11:65248431-65248453 TGCAGGCTGTTCCTTCCTGGCGG - Intergenic
1084191891 11:67503282-67503304 TCCAGTATGCTCCCACCTTGGGG - Intronic
1085895798 11:80638263-80638285 TTCAGAGTGGTCCTACCTTGAGG + Intergenic
1086092565 11:83019563-83019585 TCCAGTTTGCTTCTTCCTTCAGG + Intronic
1086414673 11:86576731-86576753 TGCTGTGTGCTTCTTCATTCAGG + Intronic
1086791785 11:91048766-91048788 TGCAGTGTCCTCCTTACTCTTGG - Intergenic
1087008590 11:93492687-93492709 TTCAGGCTGCTCCTGCCTTGTGG - Intronic
1087405360 11:97722920-97722942 TGGAGTGTGCTCCTCCTGTGGGG - Intergenic
1087667455 11:101067124-101067146 TGAAGTGTGTTTCTGCCTTGGGG + Intronic
1088641224 11:111874882-111874904 TGCAGTGTGATCCTTCATTGCGG - Exonic
1090228373 11:125084989-125085011 TGGAGAGTGCTCCTGCCTTGGGG + Intronic
1092398193 12:8146799-8146821 GGCAGTCTGCTCCTTCCTCTGGG - Intronic
1093482587 12:19620015-19620037 AGCAGAGTGTTCCTTCATTGAGG + Intronic
1094087814 12:26613048-26613070 TGAAGTGTGTTCGTTCGTTGAGG + Intronic
1095463737 12:42468778-42468800 TGCAGTGTTCGCCTCCCGTGCGG - Exonic
1095844593 12:46731415-46731437 TGCAGTGGGGTCCTTCCTCAAGG + Intergenic
1096103440 12:48982861-48982883 TGCAGGGTTCTTCTTCCTCGTGG + Intergenic
1097843565 12:64344231-64344253 TGTAGTGGGGTCCTTCCTTAAGG + Intronic
1100001620 12:89843723-89843745 TGCACAGTGCTCTTTCCTTCTGG + Intergenic
1103161631 12:118734110-118734132 TGCAGTGTGGTCCTCCTGTGGGG + Intergenic
1103341996 12:120225746-120225768 GCCAGTGTGATCCTTCCTTGTGG + Intronic
1103408486 12:120693233-120693255 TGCAGGATGCTCCAGCCTTGTGG + Intronic
1103422469 12:120798611-120798633 TGAAGACTGCTCCTTCCCTGTGG + Intronic
1106243350 13:27927209-27927231 TTGAGAGTGCTCTTTCCTTGCGG + Intergenic
1108721502 13:53137284-53137306 CCAAGTATGCTCCTTCCTTGGGG + Intergenic
1111057985 13:82974430-82974452 TGTAGTGGGGTCCTTCCTTAAGG + Intergenic
1112057914 13:95707769-95707791 TGCAAGTTGGTCCTTCCTTGAGG - Intronic
1112252436 13:97794553-97794575 TGCATTGTGCCCCTGCCTTAGGG - Intergenic
1112388077 13:98958415-98958437 CCCAGTTTGTTCCTTCCTTGGGG + Intronic
1113007604 13:105724828-105724850 TTCAGTCTGCTCCTTCATGGTGG + Intergenic
1113563617 13:111303784-111303806 TGCCGTATGGGCCTTCCTTGAGG - Intronic
1113662610 13:112117663-112117685 TGCAGTCTCCTCCATCCCTGTGG - Intergenic
1114644766 14:24249242-24249264 TGTAGTGTGCCCCTATCTTGGGG + Exonic
1116942511 14:50804505-50804527 TGCTGTGTGTTCCATCCTTTGGG - Intronic
1119073663 14:71613863-71613885 TGCAGTCTCCTCCTTCCTTCAGG - Intronic
1119534624 14:75393198-75393220 AGCAGTTTGCTCTTTCCTGGAGG + Intergenic
1121108201 14:91294387-91294409 TGCAGTGGCCTTCTTCCTTTGGG - Intronic
1124029429 15:25996288-25996310 TGCATTGTGGTACTTCCTTGTGG + Intergenic
1125338431 15:38651303-38651325 TGAAGTGTGCTTATTCCATGTGG - Intergenic
1128811937 15:70579385-70579407 TGCAGTGAGCTCCGTCCTTGAGG - Intergenic
1129838876 15:78731219-78731241 TGCTGTGTGCTCCTTGCTCTGGG - Intergenic
1130758221 15:86789290-86789312 TGCATTATGCTACTTCCCTGGGG - Intronic
1130887903 15:88109290-88109312 TGCAGAGTGCTCCTTTGGTGAGG - Intronic
1131650997 15:94399675-94399697 TCCACTTTGCTCATTCCTTGGGG - Intronic
1132758321 16:1496628-1496650 TGGAGTGCGCTCCTTCCCTGTGG + Intronic
1135669453 16:24362527-24362549 TGCAGGGAGATCCTTCCTAGTGG - Exonic
1141759507 16:86018570-86018592 TGGGGTGGGCTCCTTGCTTGGGG + Intergenic
1141850064 16:86639081-86639103 TGCAGCGTGTTCCTTTGTTGAGG + Intergenic
1142358298 16:89614262-89614284 TGCCGGCTGTTCCTTCCTTGTGG + Intronic
1143615219 17:8045572-8045594 TGCCGAGTTCTCCTTCCATGAGG + Exonic
1143919517 17:10319688-10319710 TGCAATTTGCTCCTTTCTTTTGG - Intronic
1144872470 17:18379570-18379592 AGCAGTGTGCTCCTGGCCTGGGG + Intronic
1148623532 17:49052392-49052414 TGCAGTGTTCAGTTTCCTTGGGG + Exonic
1148705143 17:49623508-49623530 TGCCATGGGCTCCTTCCTTTGGG + Intronic
1149119355 17:53142898-53142920 AGCAGTGTGCTGCTTCCTGCTGG - Intergenic
1151412277 17:73939022-73939044 TGCAGTTTGCTCTTTCCTGTAGG - Intergenic
1153858340 18:9173572-9173594 GGCAGTCTGCTCCTTCCCTTGGG + Intronic
1156136696 18:34048719-34048741 GGCTATGGGCTCCTTCCTTGAGG + Intronic
1156990486 18:43402169-43402191 TGCAGTGGGGTCCTTCCTCAAGG + Intergenic
1164727624 19:30476909-30476931 TCCAGTGTGGTCCTGCCTTGGGG + Intronic
925216084 2:2096989-2097011 TGCAGCGTCCTTCATCCTTGTGG + Intronic
926721638 2:15965626-15965648 TTCAGAGTGGGCCTTCCTTGGGG + Intergenic
929457024 2:42073310-42073332 TGCAGACTGCTCCTTCCATTGGG - Intergenic
929688095 2:44051816-44051838 TGCTGTGTGTTCCCTCTTTGAGG - Intergenic
931691377 2:64837395-64837417 TGCAGTGTGCTCATTGCTCAGGG - Intergenic
932082332 2:68726420-68726442 CTCAGTGTGCTCCTTCCTGTTGG + Intronic
935619586 2:105117120-105117142 TGCACTGTGCTCCCTTCTGGGGG - Intergenic
937726769 2:125176030-125176052 TGCAGTGTGCATGTTGCTTGTGG - Intergenic
938994399 2:136661950-136661972 TGCACTTTGTTCCTGCCTTGTGG + Intergenic
940472284 2:154114574-154114596 TGTAGTGGGGTCCTTCCTTAAGG + Intronic
941055023 2:160777343-160777365 GGCTGTGTGCTCTTACCTTGAGG - Intergenic
941667807 2:168259711-168259733 TGCAGTGGGGTCCTTCCTCAAGG - Intergenic
945122179 2:206468441-206468463 TGGACTGTGCCCCTGCCTTGGGG - Intronic
946990021 2:225318234-225318256 TGCATTGTGCCCCTGCCCTGGGG + Intergenic
947279080 2:228428177-228428199 TGCGGTGTCCTCATTCATTGAGG - Intergenic
947851914 2:233295096-233295118 TGCAGTGTGCACCCACCTTCTGG - Exonic
1169362551 20:4963199-4963221 TGAATTGTGCTCCTTGCTTTGGG - Intronic
1170122016 20:12922241-12922263 TGCATTGTGCCCCTGCCCTGGGG + Intergenic
1170729580 20:18961627-18961649 TGCTGTTTTCTCCTTCCTTTGGG + Intergenic
1170893876 20:20397269-20397291 TGCTGTGTGTTCCCTCCCTGGGG - Intronic
1171820745 20:29835847-29835869 TGTAGAGTGCTCCTGCCCTGTGG - Intergenic
1173655310 20:44696372-44696394 TGAAGTGTGCCACTTCCTGGGGG + Intergenic
1174277512 20:49414587-49414609 TGCATTTCCCTCCTTCCTTGTGG - Intronic
1174865005 20:54127201-54127223 TGCAGCTTGTTCCTTACTTGAGG + Intergenic
1176302713 21:5106195-5106217 GGCAGTTTGCTCCTGCCATGTGG - Intergenic
1179854311 21:44155728-44155750 GGCAGTTTGCTCCTGCCGTGTGG + Intergenic
1182071515 22:27467005-27467027 TGCAGGGTGTTCCTGCCTTGGGG + Intergenic
1182484184 22:30629457-30629479 TGCACTGTACTCCAGCCTTGGGG + Intergenic
1182730840 22:32490930-32490952 TGCACTGTACTTCTTCCATGAGG + Intronic
1183274531 22:36885303-36885325 TGCAGTGTGCTTCTTGGTTTGGG + Intergenic
1184933441 22:47699031-47699053 TGCAGTGCGCTCCTTACCTTGGG + Intergenic
950187624 3:10955013-10955035 TGCAGTGTGGTCCGTGCATGTGG - Intergenic
951301231 3:20999570-20999592 TGCATTCTGCTCCTTGCTTTTGG - Intergenic
951589368 3:24246306-24246328 TGAAGTGTGTTCCTTTCATGGGG + Intronic
953378386 3:42447711-42447733 TGCAGAGTTGTCCTGCCTTGAGG - Intergenic
954008584 3:47614295-47614317 TGCAGTGTGCTTGCTTCTTGAGG + Intronic
958970105 3:100601590-100601612 TGGATTATGCTCCTTTCTTGGGG + Intergenic
959879614 3:111428573-111428595 TACATTGTGCTCCTGCCTTAGGG + Intronic
960724817 3:120659419-120659441 TGCATTGTGCTCCTGCCCTAGGG - Intronic
962906786 3:139810868-139810890 TGCAGTGTGATCCTTTCTTTTGG + Intergenic
963654312 3:148025676-148025698 TGCAGTGTGAACCTTGATTGTGG + Intergenic
964590789 3:158360652-158360674 TGCAGTGTGCACATACCTGGCGG + Intronic
964606220 3:158562885-158562907 AGCAGTGTGAGCCTTCCTGGAGG + Intergenic
964677493 3:159300018-159300040 TGGAGTGTCCTCTTTCCCTGAGG + Intronic
966201497 3:177363065-177363087 TGCAGAGTGGTCTTTCCCTGTGG - Intergenic
967166959 3:186789329-186789351 TGCATTGTGCTTCTTTCTTTGGG + Exonic
969467168 4:7364536-7364558 GGCAGTCTCCTCCTTCCTTGGGG + Intronic
972883169 4:43449629-43449651 TGTAGTGTGGTCCTTCCTCTAGG + Intergenic
974474602 4:62362396-62362418 TGCAGTCTGGTCCTGCCTTTTGG + Intergenic
974534262 4:63154369-63154391 TGGAGTGTGCTCCTCCTGTGGGG + Intergenic
975026040 4:69550001-69550023 TGTAGTGTGCTTCTTGATTGAGG + Intergenic
976926808 4:90508540-90508562 TAGAGTTTGCTCCTTTCTTGAGG - Intronic
977624851 4:99179253-99179275 TGGAGGGTGCTCCTTCTGTGGGG + Intergenic
977701945 4:100031368-100031390 TGTAGTGGGGTCCTTCCTTAAGG + Intergenic
977874064 4:102128768-102128790 TGCATTGTGCTCCTGCCGTAGGG + Intergenic
978372613 4:108044142-108044164 TGCAGTGTTCTCATTCCATCTGG + Intergenic
979753838 4:124314545-124314567 TGCAGTCAGCTGCTTCCTTCAGG + Intergenic
982797649 4:159664717-159664739 AGCATTGTGCTCCTGCCCTGGGG - Intergenic
982826888 4:160013462-160013484 TCCAGTGTGCTCCTTCTCTCTGG + Intergenic
983807802 4:172017390-172017412 TGGAGTGTGCTCCTCCTGTGGGG + Intronic
985607448 5:865635-865657 GGCAGTGTGCTCCTGCCCTTAGG - Intronic
985944161 5:3163746-3163768 TGCAGAGTGCCGCTTCCTGGAGG + Intergenic
986526906 5:8688753-8688775 TGCTGGGGCCTCCTTCCTTGAGG - Intergenic
986927193 5:12769621-12769643 AGTAGTGTGCACCTTCCTAGGGG - Intergenic
987101342 5:14593842-14593864 GGCAGTGTGCCCCATCCTGGGGG + Intronic
987106469 5:14644787-14644809 TGGTGTGTGCTCCTTCCTTTTGG - Intergenic
988690184 5:33564106-33564128 TGCAATGTCCTCCTGCCTTCTGG - Intronic
989401815 5:41015878-41015900 TTCAGTGAGCTCCCTCATTGGGG + Intronic
991293671 5:65059047-65059069 TGCATTGTGCTCCTGCCTTAGGG + Intergenic
991502973 5:67295466-67295488 GGCAGTGGGCTCCTATCTTGAGG - Intergenic
992666358 5:79013254-79013276 TGCATTGTGCTCCTGCCCTAGGG - Intronic
993390353 5:87313336-87313358 TGCATTGTCCTCCTACCCTGTGG - Intronic
994909677 5:105886437-105886459 TGCAGTTTGCCTCTTCCTTCAGG - Intergenic
994984614 5:106917197-106917219 TGTAGTGGGCTCCTTCCTCAAGG + Intergenic
995531642 5:113096891-113096913 TTCAGTGTGCTCCTTCCACATGG - Intronic
996825358 5:127676353-127676375 TGCAGTGGGGTCCTTCCTCAAGG - Intergenic
1000988394 5:167886078-167886100 CACAGTGTGCTCCTGCCTGGTGG + Intronic
1001084045 5:168687402-168687424 TTCAGTTTGGTCCTTCCTTTGGG + Intronic
1001631765 5:173180556-173180578 AGCAGGGTGCCTCTTCCTTGAGG - Intergenic
1003864550 6:10351177-10351199 AGCAGTGTGCTCCTTCTGGGTGG - Intergenic
1005475552 6:26204261-26204283 TGCAGTAATCTCCTTCCATGAGG - Intergenic
1005622669 6:27634466-27634488 TGTAGTGGGGTCCTTCCTCGAGG + Intergenic
1010343078 6:74780217-74780239 TTTAATGTGCTCCATCCTTGAGG - Intergenic
1010552240 6:77237352-77237374 TACAGTGGGGTCCTTCCTTAAGG - Intergenic
1011753801 6:90478963-90478985 TGCAGGGTGCTCCTTTCTAGAGG + Intergenic
1012035106 6:94126634-94126656 TACAGTGTGATCCTTACTTTTGG + Intergenic
1012079499 6:94737176-94737198 CGGAGTGTGCTCCTCCTTTGTGG - Intergenic
1012390194 6:98729537-98729559 TGCAGTGGATTTCTTCCTTGTGG + Intergenic
1013217921 6:108047025-108047047 TGCAGTTAGCTCCTCCCTTCAGG + Intronic
1013314426 6:108927431-108927453 TGCAGTGTGCTCCTTCCTTGTGG - Intronic
1013842374 6:114412889-114412911 TGCAGTGTGCTCATTGCTAGTGG - Intergenic
1014538137 6:122641518-122641540 TGCAATCTGATCCTTCATTGTGG - Intronic
1015365371 6:132391869-132391891 AGCTGTGTGCTTCTTCCTGGCGG - Intronic
1016846267 6:148571259-148571281 TGAAGTGTGTTTCTTCCTTCAGG + Intergenic
1019002926 6:168770609-168770631 TGTAGTGGGGTCCTTCCTTAAGG - Intergenic
1019797518 7:3062850-3062872 CCCAGTGTGCTCCACCCTTGGGG + Intergenic
1019867110 7:3722375-3722397 CCCAGGGTGCCCCTTCCTTGCGG - Intronic
1020279235 7:6642029-6642051 GGCTGTGTGATGCTTCCTTGTGG + Intronic
1021615972 7:22503777-22503799 TACAGTGTGCTCCCTCCATGTGG - Intronic
1022925767 7:35054980-35055002 TACAGTGTGCTCCCTCCATGTGG - Intergenic
1023145344 7:37145512-37145534 TACAGTTTGCTACTTCCCTGCGG - Intronic
1023332197 7:39130295-39130317 TGCAGTGTTCTCCTGCCTTCCGG - Intronic
1024012355 7:45279835-45279857 GGAAGTGTTCTCCTTCCTTCTGG + Intergenic
1024308796 7:47950271-47950293 TGCTGCCTGTTCCTTCCTTGTGG + Intronic
1026466730 7:70660831-70660853 TGCATTGTTGTCCTTCCATGAGG + Intronic
1027943251 7:84711874-84711896 AGTAGTCTGCTCATTCCTTGAGG + Intergenic
1028376498 7:90150565-90150587 TACAATGTGCTCCCTCCATGTGG + Intergenic
1029249662 7:99226796-99226818 TGGAGTGTGCTCTTTCCTGCTGG + Intergenic
1031068932 7:117140862-117140884 TTCAAAGTGCTCCTTCCTTCAGG + Intronic
1034936529 7:155203899-155203921 TTCAGGGAGCTCCTGCCTTGGGG + Intergenic
1035073760 7:156163638-156163660 TGCAGGGTCCTCCTTCTCTGTGG - Intergenic
1036047069 8:5155203-5155225 TGCACTGTGCAACTTCCTTCCGG + Intergenic
1036085043 8:5604353-5604375 TGACGTGTGCTCCTTCCTGGAGG - Intergenic
1036202939 8:6784460-6784482 TGCAATGTGCCCCAGCCTTGTGG - Intergenic
1036719420 8:11159361-11159383 TGCATTGTGGTCATTACTTGGGG - Intronic
1038093174 8:24277493-24277515 TTAAGTGTGCTTCCTCCTTGTGG + Intergenic
1039330425 8:36531421-36531443 TGTAGTGTGGTCCTTCCTCAAGG - Intergenic
1040803124 8:51365501-51365523 TGGAGTATGCTCCTTACCTGGGG - Intronic
1040914586 8:52555853-52555875 TGCACTGTGCTCCTGTCTTTAGG + Intronic
1042792124 8:72619621-72619643 TGCAGGGCACTTCTTCCTTGAGG - Intronic
1045952278 8:107865590-107865612 TGCTGTTTTCTCCTTCCTGGGGG + Intergenic
1046094013 8:109537314-109537336 TGCAGTCTGCTCCTACCTCCTGG + Intergenic
1046673350 8:117081691-117081713 TGCCAAGTCCTCCTTCCTTGTGG - Intronic
1047850475 8:128851925-128851947 GGCAGTGTGTTCCTTTCTGGAGG - Intergenic
1048165216 8:132056214-132056236 TACAAAGTGCTCCTTCCTTCGGG - Intronic
1049011412 8:139890087-139890109 TGCAGGGCGCTGCTTCCTTGAGG - Intronic
1049848765 8:144819652-144819674 TGGAGGGCGCTGCTTCCTTGTGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052058644 9:23932535-23932557 TGCAGTGAGCTCCTGCAGTGAGG - Intergenic
1052865429 9:33462107-33462129 GGCATTGTGCTCCTTCAATGTGG + Exonic
1053267565 9:36726254-36726276 TGCAGTTTTCCCCTTCATTGTGG + Intergenic
1055244299 9:74221071-74221093 TGCTGTTTTCTCCTTTCTTGGGG - Intergenic
1056542371 9:87583374-87583396 TGCTGAGTGCTCCTGCCTAGTGG - Intronic
1056655423 9:88504800-88504822 TGGTGTGAGCTCCTTCCCTGAGG - Intergenic
1056688337 9:88784816-88784838 TGCCGTTTCCTCCTTCTTTGAGG - Intergenic
1060697800 9:125724177-125724199 AGCAGCATGCTCCTTCCATGCGG - Intergenic
1060916588 9:127395629-127395651 GGCAGGGTGCTCCTACCCTGTGG - Intergenic
1062507409 9:136885228-136885250 TGCAGTGTATTCCATCCTTGAGG + Intronic
1185511802 X:669314-669336 GGCAGTGTGATGATTCCTTGAGG + Intergenic
1185771119 X:2766454-2766476 TGAACAGTGCTCCTTCCTTCCGG + Intronic
1188665063 X:32809222-32809244 TGCAGTATGCTCCATCCATAGGG + Intronic
1188956207 X:36437202-36437224 TGCAGGGTGCTCCTTCTGTGGGG - Intergenic
1189185129 X:39048528-39048550 TGCAGTGGGTTCCTTCCTGGTGG + Intergenic
1190971870 X:55357265-55357287 GGCAGCCTGCTCCTTCCTGGGGG - Intergenic
1191614972 X:63160958-63160980 CACGGTGTGCCCCTTCCTTGTGG - Intergenic
1191621324 X:63217965-63217987 CACGGTGTGCCCCTTCCTTGTGG + Intergenic
1192377486 X:70578458-70578480 TACAGTGTTCACCTTCCCTGCGG - Intronic
1193164249 X:78263710-78263732 TGCAGCCTGCTCCTTCCTCTGGG + Intergenic
1193832749 X:86308632-86308654 TGTAGTGTGGTCCTTCCTCAAGG - Intronic
1194444891 X:93975531-93975553 GGCAGCCTGCTCCTTCCTTTGGG + Intergenic
1197051709 X:122066961-122066983 GGCAGTGTGGTGATTCCTTGAGG + Intergenic
1197107437 X:122732508-122732530 GGCAGTGTGTTCCTTCCTCTGGG - Intergenic
1197473481 X:126891526-126891548 TGCAGTGTGCCCCTTACCTAGGG - Intergenic
1197969708 X:132102111-132102133 TTCAGTGTGGTGCTGCCTTGAGG - Intronic
1198564229 X:137886999-137887021 TGCACTGGGCTCCTTCCTCTGGG - Intergenic
1198745928 X:139890581-139890603 TTCAGTTTACTTCTTCCTTGGGG - Intronic
1199329628 X:146543584-146543606 TGCATTGTGCCCCTGCCCTGGGG - Intergenic
1199627279 X:149752070-149752092 TGTAGTGGGGTCCTTCCTTAAGG + Intergenic
1200187753 X:154193909-154193931 TGCCGTGTGCTCTTCCCTTCCGG + Intergenic
1200638147 Y:5681930-5681952 TGCATTGTGCCCCTGGCTTGGGG - Intronic