ID: 1013315660

View in Genome Browser
Species Human (GRCh38)
Location 6:108940277-108940299
Sequence ACATGGACACACATGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 3, 1: 8, 2: 28, 3: 77, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013315654_1013315660 20 Left 1013315654 6:108940234-108940256 CCAGCCTGGGTGACAGAGGAAGA 0: 468
1: 33436
2: 114170
3: 175711
4: 175107
Right 1013315660 6:108940277-108940299 ACATGGACACACATGGAGTGAGG 0: 3
1: 8
2: 28
3: 77
4: 333
1013315652_1013315660 30 Left 1013315652 6:108940224-108940246 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1013315660 6:108940277-108940299 ACATGGACACACATGGAGTGAGG 0: 3
1: 8
2: 28
3: 77
4: 333
1013315655_1013315660 16 Left 1013315655 6:108940238-108940260 CCTGGGTGACAGAGGAAGACTCT 0: 144
1: 11522
2: 58129
3: 129908
4: 175489
Right 1013315660 6:108940277-108940299 ACATGGACACACATGGAGTGAGG 0: 3
1: 8
2: 28
3: 77
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013315660 Original CRISPR ACATGGACACACATGGAGTG AGG Intronic
900489187 1:2938100-2938122 ACATGCACACACATACAGAGAGG + Intergenic
900648272 1:3718682-3718704 AGTTGGACACAGATGGAGTAAGG - Intronic
903589777 1:24445942-24445964 ACATGGAAACCCAAGAAGTGGGG + Intronic
905708372 1:40079774-40079796 TGATGGACACCTATGGAGTGTGG - Intronic
906109036 1:43311420-43311442 ACATGGCCAGACATGGTTTGGGG - Intronic
906220448 1:44074222-44074244 AGATGGGTACACATGGGGTGAGG - Intergenic
907503887 1:54903179-54903201 ACATGGACACACATGAAATTTGG - Intergenic
907887353 1:58605839-58605861 ACATGAACACATGTGGAGTGAGG + Intergenic
908007189 1:59739030-59739052 ACCAGAACAGACATGGAGTGGGG + Intronic
908962472 1:69714625-69714647 ACATGAACAAAGATGTAGTGGGG + Intronic
909153217 1:72035295-72035317 ACACGGACACACAGGAAGAGTGG - Intronic
909223979 1:72993149-72993171 ACATGGACGCACATGAAATTTGG - Intergenic
910070575 1:83208479-83208501 ACATGGACACGCGAAGAGTGAGG + Intergenic
910290562 1:85596444-85596466 ACATGCACACACATGGTCAGGGG + Intergenic
911070586 1:93829009-93829031 ACATGGACACACACGAGGAGTGG + Intronic
912296173 1:108473379-108473401 ACATGGACGCACATGAAATTTGG + Intergenic
913377177 1:118165391-118165413 ACACAGACACACATGGAGTGAGG - Intronic
914335423 1:146710633-146710655 ACAGGGAAACTTATGGAGTGGGG + Intergenic
915091424 1:153428958-153428980 TCCAGGAGACACATGGAGTGGGG - Intergenic
916207954 1:162333484-162333506 ATATGAATACACATGGAGTCTGG + Intronic
916381236 1:164214117-164214139 AAAAGGAAAGACATGGAGTGGGG + Intergenic
917002651 1:170376296-170376318 ACATGCACACATGTGGTGTGTGG - Intergenic
917299066 1:173554216-173554238 ACATGGACACACATGGGCAAGGG - Intronic
917662186 1:177187518-177187540 ACAGGGTCAGGCATGGAGTGAGG + Intronic
918685992 1:187416353-187416375 ACATATACACACAAAGAGTGAGG - Intergenic
918794600 1:188876481-188876503 ACATGGAAACTTATGCAGTGTGG + Intergenic
919893620 1:201994163-201994185 ACATCGACACACAAGGAGCTGGG - Intronic
920381379 1:205536445-205536467 GCATGGCCACACAGGGAGTAAGG + Intergenic
921508984 1:216008538-216008560 ACATGGACGCACATGAAATTTGG + Intronic
923258580 1:232244319-232244341 ACAAAGGCACACATGGACTGTGG + Intergenic
924474272 1:244369505-244369527 ACGTGAACACACAAGGAGTGAGG + Intronic
924895411 1:248333159-248333181 ATGTGGACACACAAAGAGTGAGG + Intergenic
1064188283 10:13182974-13182996 ACAAGGACACACATTGTGTCAGG - Exonic
1064339039 10:14470234-14470256 ACGTGGACACACAAAGAGTGAGG - Intergenic
1064803094 10:19098741-19098763 ACGTGAACATACAAGGAGTGAGG + Intronic
1065443679 10:25775743-25775765 ACACAGACACACAAAGAGTGAGG + Intergenic
1066422028 10:35272454-35272476 ACATGGACACAAAGGGTGTGAGG - Intronic
1066619204 10:37325955-37325977 ACATGGACACACAAAAAGTGAGG - Intronic
1067019765 10:42784678-42784700 ACATGGAGATTCATGGTGTGTGG + Intronic
1067081102 10:43212602-43212624 GCAGGGAGACACATGGAGTGTGG + Intronic
1068175235 10:53448501-53448523 ATGTGGACACACAAGGAGTGAGG + Intergenic
1068578209 10:58708442-58708464 ACACGGACACACATGGAGTGAGG + Intronic
1068592721 10:58866874-58866896 ACATGGACACACATGAAATTTGG - Intergenic
1069180100 10:65348555-65348577 ACACAGACACACATGAAGAGTGG + Intergenic
1069627960 10:69880107-69880129 ACAGGGAGACACAGGGAGAGAGG - Intronic
1069755062 10:70769487-70769509 ACACAGACACACAAAGAGTGAGG - Intergenic
1069990301 10:72311063-72311085 ATATGTACACACCTGGTGTGTGG - Intergenic
1070132308 10:73664249-73664271 TCATGAACACAAGTGGAGTGAGG + Intergenic
1070834332 10:79438454-79438476 ACATGGCCACACCTTGACTGAGG + Intronic
1071045462 10:81369566-81369588 GCAGGGACACAGATGGAGTTTGG - Intergenic
1071196039 10:83161252-83161274 CCTTGGACACATATGGAATGTGG - Intergenic
1071609372 10:87019827-87019849 TCATGAACACAAGTGGAGTGAGG - Intergenic
1071898035 10:90086334-90086356 ACATGGACACGCATGAAATTTGG - Intergenic
1072167635 10:92829429-92829451 ACATGGACACGTATGGAGTGAGG - Intergenic
1072692795 10:97582872-97582894 ACATAGACACACATAGAGAATGG - Intronic
1073217468 10:101844171-101844193 ACATGGAGACAAACGGAGCGGGG - Intergenic
1073292232 10:102419013-102419035 ACGTGGACACAAGTGGGGTGGGG - Exonic
1073436781 10:103521827-103521849 ACATGGACACACATGACATTTGG - Intronic
1073893937 10:108132295-108132317 ACATGGACACACATGGAGTGAGG + Intergenic
1074777954 10:116779873-116779895 CCATGGGCCCACATGGAGTCGGG - Intergenic
1075143461 10:119862367-119862389 CTAAGGACACACATGGAGTCTGG - Intronic
1075725116 10:124607026-124607048 ACACGGCCACACACGGAGGGAGG - Intronic
1075832087 10:125419995-125420017 ACAAGGACACAGAGGGCGTGGGG + Intergenic
1075978335 10:126716223-126716245 ACATGGACACACAAAGGGTGAGG - Intergenic
1076191743 10:128488001-128488023 AAGTGGACAGACATGGAATGGGG + Intergenic
1076277201 10:129211492-129211514 ACATGAAGACAAAAGGAGTGGGG + Intergenic
1079501391 11:21105185-21105207 ACACAGACACACGTGGAGTGGGG + Intronic
1080028246 11:27634472-27634494 ACACGGACACACATGAAATTTGG - Intergenic
1080056954 11:27916403-27916425 ACAGGGAGACACTTGCAGTGAGG - Intergenic
1080107599 11:28526636-28526658 ACATGAAGACACATGGAGAGGGG + Intergenic
1080723468 11:34871811-34871833 ACATGGACACACAAAGAGTGAGG - Intronic
1080918104 11:36680594-36680616 ACACGGACACACATGAGGAGTGG - Intergenic
1081168381 11:39835394-39835416 ACATGGACACATAGAGAGAGGGG + Intergenic
1081363074 11:42203719-42203741 ATGTGGACACACAAGGAGTGAGG - Intergenic
1081530344 11:43954285-43954307 ACACAGACACACAAGGAGTGAGG + Intergenic
1085220445 11:74869897-74869919 ACCTGGGCACACAAAGAGTGAGG - Intronic
1086816722 11:91381101-91381123 ACACAGACACACAAAGAGTGAGG + Intergenic
1087942942 11:104122594-104122616 ACATGGACACATAAAGAGTGAGG - Intronic
1088034929 11:105299921-105299943 ACATGGACACAGATGGAAACAGG + Intergenic
1089472396 11:118731439-118731461 ACATGGACGCACATGAAATTTGG - Intergenic
1089852995 11:121516414-121516436 AGATGGCCACACAGGGAGTCAGG + Intronic
1093578422 12:20763343-20763365 ACATGGACACACATGAAATTTGG + Intergenic
1093584802 12:20822180-20822202 ACATGGACACACATGAAATTTGG - Intronic
1093594641 12:20946014-20946036 ACATGGACACACAAAGAGTGAGG + Intergenic
1094091002 12:26649694-26649716 ATATGGAGACTGATGGAGTGAGG - Intronic
1095659992 12:44721413-44721435 ACATGGACACACATGAAGAAAGG + Intronic
1095734940 12:45546595-45546617 ACATAAACAAACATGGAGTAGGG + Intergenic
1095949638 12:47774864-47774886 ACCTTGACAAACATGGAGGGTGG - Intronic
1096939568 12:55327127-55327149 ACATGGACACATAAGGAGTGAGG - Intergenic
1097303723 12:58046123-58046145 ACTGGTACACTCATGGAGTGTGG - Intergenic
1097489118 12:60242155-60242177 ATGTGGACACACAAAGAGTGAGG + Intergenic
1098673828 12:73264809-73264831 ACAAGGCCTCACATGAAGTGGGG + Intergenic
1098720231 12:73888501-73888523 ACTTGGACACACAAGGAGTGAGG + Intergenic
1100815817 12:98386175-98386197 ACACGGACACATCTGGAGTGAGG - Intergenic
1102034198 12:109761624-109761646 ACAGGGAGACACATGGAAAGAGG - Intronic
1104099187 12:125590070-125590092 ACATGGTCAGAGAGGGAGTGAGG - Intronic
1104511125 12:129379201-129379223 ACATGCACACACACAGAGTCAGG + Intronic
1104522255 12:129486598-129486620 CCCTGGACACACAATGAGTGGGG - Intronic
1104781714 12:131425700-131425722 ACGTGGACACACAAAGAGTGAGG + Intergenic
1107159651 13:37211211-37211233 ACAGTGACACATGTGGAGTGAGG + Intergenic
1107271620 13:38625253-38625275 ACACAGAAACACAAGGAGTGAGG - Intergenic
1107646376 13:42498127-42498149 AAGGGGACACACATGAAGTGTGG + Intergenic
1107799360 13:44089834-44089856 ACATAGACACACACAGAGAGAGG - Intergenic
1108713552 13:53057281-53057303 ATGTGGACACACAAGAAGTGAGG + Intergenic
1108919862 13:55660350-55660372 ACATGGACACGCATGAAATTTGG - Intergenic
1109387822 13:61656022-61656044 ACATGGCCACACATTCAGAGGGG - Intergenic
1109468993 13:62779686-62779708 ACATGGACACACAAAGAGTGAGG - Intergenic
1109660827 13:65458378-65458400 ACATGGACACATGTGGAGTGAGG + Intergenic
1110666626 13:78124954-78124976 ACAGGGACACACATGAAGAGTGG + Intergenic
1111024564 13:82502538-82502560 ATGTGGACACACAATGAGTGAGG + Intergenic
1111649080 13:91066962-91066984 ACGTGGACACATAAGGAGTGAGG + Intergenic
1112258689 13:97858154-97858176 ACATGGTCACTCAAGGAATGGGG + Intergenic
1112650903 13:101397195-101397217 ACATGTAAACACATGTAGTCTGG + Intronic
1113456974 13:110456288-110456310 ACATGCACACACACGGAGTTAGG - Intronic
1116535087 14:46017690-46017712 ACATGGACACACATGAAATTTGG - Intergenic
1116786895 14:49297612-49297634 AGATGGTCACACACGGAGAGCGG - Intergenic
1116918328 14:50547052-50547074 ACATGGACACAGGGGGAGGGGGG + Intronic
1117018062 14:51539278-51539300 AAAGGGACAGACATGGACTGAGG - Intronic
1119022088 14:71124599-71124621 ACATGGACACGCATGAAATTTGG + Intergenic
1119091273 14:71783494-71783516 ACGTGGACACACAAGGAGTGAGG - Intergenic
1119717626 14:76869954-76869976 ACATGCACACATGTGTAGTGGGG + Intronic
1121262141 14:92574108-92574130 ACACGGACACACAAGAAATGAGG + Intronic
1121678871 14:95776352-95776374 ACATGGAAACATAAGGAGTAGGG - Intergenic
1121703343 14:95973415-95973437 ACATGGACGCACATGAAATTTGG + Intergenic
1121871815 14:97414961-97414983 ACGTGGAAACACATGCAGAGGGG + Intergenic
1123146386 14:106134738-106134760 ACACAGACACACAAAGAGTGAGG + Intergenic
1123922626 15:25081169-25081191 CCCTGGACATACATGGTGTGGGG + Intergenic
1124258393 15:28164398-28164420 GCATGGAGACACAAGGAGTAAGG + Intronic
1124843085 15:33263107-33263129 ACATGGACATACATGGTGGCAGG - Intergenic
1125267975 15:37905652-37905674 ACACGCACACACAGGCAGTGGGG - Intergenic
1126971067 15:54112224-54112246 ACATGAACACTTGTGGAGTGAGG + Intronic
1127737496 15:61857830-61857852 ACATGGTGACCAATGGAGTGTGG + Intronic
1128459177 15:67853151-67853173 ACATGGACACACAAGGAGTGAGG + Intergenic
1128810496 15:70567696-70567718 ACATGTAGACACATGGTATGTGG - Intergenic
1128922048 15:71619777-71619799 AAATGCATACACATGGAGGGAGG + Intronic
1129868771 15:78927982-78928004 AGGTGGGCACACATGGTGTGTGG + Intronic
1131319041 15:91368579-91368601 ACATGGACACGCATGGAGTGAGG + Intergenic
1131322108 15:91404407-91404429 ACATGCACACACATGCTGAGTGG - Intergenic
1131655019 15:94447238-94447260 ACAAGGAAACACAGGGAATGAGG - Intronic
1131882836 15:96877210-96877232 ACATGGACGCACATGAAATTTGG - Intergenic
1131979024 15:97977834-97977856 ACACAGATACACAAGGAGTGAGG + Intergenic
1132156019 15:99495633-99495655 ACAGGGACAGAGATGGAGAGGGG + Intergenic
1133520843 16:6555075-6555097 ACATGGAAACACAGGGAAGGAGG + Intronic
1133869925 16:9676815-9676837 ACATGGACACACATGAAATTTGG - Exonic
1136093751 16:27938932-27938954 ACATGAACAAACATGGACTGTGG + Intronic
1137325776 16:47434982-47435004 ACATGGACACATAGGGTGCGGGG + Intronic
1137564940 16:49527035-49527057 ACATGAACACAGATGGGCTGAGG + Intronic
1138042323 16:53685660-53685682 ACATGGACACATAGGGTGGGGGG + Intronic
1138203833 16:55109858-55109880 AGAGGGAGACACATGGAATGTGG + Intergenic
1138554908 16:57765389-57765411 AGATGGACTCACAGGGAGCGGGG - Intronic
1138963107 16:62051182-62051204 ACGTGGACACACAAAGAGTGAGG + Intergenic
1139154221 16:64421738-64421760 ACGTGGACACACAAAGGGTGAGG + Intergenic
1139167189 16:64581022-64581044 ACACGGACATACATGAAGAGTGG - Intergenic
1140426786 16:74867807-74867829 ACACGGACACACATGGGGTGAGG - Intergenic
1141413776 16:83854422-83854444 ACAGGGACACACGTGGAGTGAGG + Intergenic
1142515097 17:422566-422588 CCATGGACAAACACGCAGTGTGG - Intronic
1142923565 17:3212758-3212780 ACGTGGATACACACAGAGTGAGG + Intergenic
1143365365 17:6404908-6404930 ACATGGACACAGGTGGGGTGGGG - Intronic
1144272951 17:13636923-13636945 ACGTGGACACAGGTGGAGTGAGG + Intergenic
1144672848 17:17142680-17142702 ACATGGAGACCAATGCAGTGGGG + Exonic
1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG + Intergenic
1145390467 17:22451954-22451976 GCATGGACACACAAAGGGTGAGG + Intergenic
1146945273 17:36869370-36869392 ACAAGGTCACACAGCGAGTGAGG + Intergenic
1148130981 17:45262473-45262495 ACTTGTGCACACAGGGAGTGTGG + Intergenic
1150899701 17:69258522-69258544 ACATGGAAACACTAGGACTGTGG + Intronic
1150954290 17:69839751-69839773 AAATGGAAACACAGGCAGTGAGG + Intergenic
1152692191 17:81723905-81723927 ACTTGGACACAAATGGAGATGGG + Intergenic
1157016250 18:43718499-43718521 ACAGGGTCACACATGGCGAGGGG + Intergenic
1157739396 18:50079274-50079296 ATATAGACACACATGTGGTGAGG - Intronic
1158008179 18:52697272-52697294 ACATACACACACATGCAATGTGG + Intronic
1158362556 18:56691263-56691285 AAATGGACAGACATGGACCGGGG + Exonic
1160503623 18:79415043-79415065 ACATGGACGCACATGGCCTGTGG - Intronic
1162880195 19:13653210-13653232 ATGTGGACACACAAGGAGTGAGG - Intergenic
1162966414 19:14158298-14158320 ACAGGGACCCCCATGGAGGGAGG + Intronic
1163037009 19:14575901-14575923 ACGTGGACACACAAGGAGTGAGG + Intergenic
1164914161 19:32037158-32037180 ACATGGAGAGACAGGGAGCGAGG + Intergenic
1165497291 19:36160587-36160609 ACATGGACGCGCATGAAATGTGG - Intergenic
1166474005 19:43104964-43104986 ACATGGAAACACATAAAGAGTGG + Intronic
1166487964 19:43230043-43230065 ACATGGAAACACATGAGGAGTGG + Intronic
1166653397 19:44592352-44592374 ACACGGACACACAAAGAGTGAGG - Intergenic
1166654902 19:44603869-44603891 ATGTGGACCCACAAGGAGTGAGG + Intergenic
1167324948 19:48818641-48818663 AGAAGGACACTCAGGGAGTGTGG - Intronic
1167886236 19:52502171-52502193 ACATGGATTAACATGGGGTGTGG + Intronic
1167891531 19:52543608-52543630 ACGTGGATAAACATGGGGTGTGG + Intronic
1167920375 19:52778567-52778589 ACATGGATAAACATGGGGTGTGG - Intronic
1168228282 19:55012009-55012031 ACATGGACGCACATGAAATTTGG - Intergenic
925328953 2:3043488-3043510 ACAGGGACAGACAGGGAGGGAGG + Intergenic
925794101 2:7524417-7524439 AAATGGACACAGAGGAAGTGAGG - Intergenic
926753400 2:16217521-16217543 ACAGGGTCACACAAGTAGTGTGG + Intergenic
930768808 2:55111822-55111844 AGATGGATAGACATGGGGTGAGG - Intronic
931026706 2:58118693-58118715 ACACGGACACACATGAAATTTGG - Intronic
931716964 2:65037023-65037045 AAATGGACAAAGATGGAGTATGG - Intergenic
931794075 2:65692834-65692856 ACATAGACTCACAAGGAGTCAGG + Intergenic
932197983 2:69800838-69800860 ACGTAGACACACAAAGAGTGAGG + Intronic
932727507 2:74192150-74192172 ACATGGACACACAAAGAGTGAGG - Intergenic
932738877 2:74276498-74276520 CCATGGACAGAGATGGGGTGTGG + Intronic
933078966 2:77965553-77965575 ACATGGACGCACATGAAATTTGG + Intergenic
933552666 2:83794066-83794088 ACATGGACGCACATGAAATTTGG - Intergenic
934032640 2:88062084-88062106 ATGTGGACACACAAAGAGTGAGG + Intergenic
935141872 2:100360531-100360553 ACATGGACACATGTGGAGTGAGG + Intergenic
935398334 2:102634145-102634167 TCATGGACAACCAAGGAGTGTGG - Intronic
935810715 2:106794476-106794498 ACCCAGACCCACATGGAGTGAGG + Intergenic
935890624 2:107674108-107674130 ACATGGACACACAAGGAGTGAGG + Intergenic
936812453 2:116418466-116418488 ACATGGACACACAAGAAGTGAGG + Intergenic
940529873 2:154867709-154867731 ACATGGACACGCATGAAATTTGG + Intergenic
940990325 2:160089327-160089349 ACACAGACACACAAAGAGTGAGG + Intergenic
941040251 2:160613567-160613589 ATATGGACAGACATGGGGTAAGG + Intergenic
941513714 2:166445632-166445654 ACATGGACACACATGTGAAGTGG - Intronic
942801073 2:179876446-179876468 ACATGGGCACACATGAAGACTGG - Intergenic
943834852 2:192506475-192506497 ACATGGACACACATGAAATTTGG + Intergenic
943873150 2:193027640-193027662 ATGTGGACACACAAGGAGTGAGG + Intergenic
944393825 2:199247336-199247358 ACATGGACACGCATGAAATTTGG + Intergenic
946173576 2:217909364-217909386 GAATGGACAGACATGGAGTAGGG + Intronic
946215374 2:218179451-218179473 ACATGGACGCACATGAAATTTGG - Intergenic
947001218 2:225458879-225458901 CCATGGACAGACAGAGAGTGTGG + Intronic
947610338 2:231521468-231521490 ACCTGGAGGCACAGGGAGTGAGG + Intergenic
1169547679 20:6667304-6667326 ACAGGGCCACACAGGGAGTAGGG - Intergenic
1170325795 20:15153145-15153167 ACATGGACACACATGAAATTTGG - Intronic
1170449094 20:16463225-16463247 ACGTGGACACACAAGGAGTGAGG - Intronic
1170472860 20:16685634-16685656 ACATGCACAAAGATGGAGTCAGG - Intergenic
1170749257 20:19130785-19130807 GTATGGACACACAGGGTGTGGGG - Intergenic
1172361838 20:34318154-34318176 ACACGGACACACAAAGAGTGAGG + Intergenic
1172830132 20:37826726-37826748 ACATGGATAAACATGTGGTGAGG - Intronic
1173912919 20:46683692-46683714 ACAGGGACCCACAAAGAGTGAGG - Intronic
1174339064 20:49884690-49884712 CCAAGGACAGACATGGTGTGGGG + Intronic
1174745476 20:53057868-53057890 ACATGGACAGAAATGGGGTCAGG + Intronic
1175825109 20:61932434-61932456 ACATGGGCACACATGTACTATGG + Intronic
1175883268 20:62272579-62272601 ACATGCACACACATGGGGTGCGG - Intronic
1176229008 20:64021451-64021473 ACATGCACACACATGCACGGGGG - Intronic
1177119253 21:17121876-17121898 ACATGGACGCACATGAAATTTGG + Intergenic
1177838719 21:26213627-26213649 CCAAGGAGACACATGGTGTGGGG + Intergenic
1179503013 21:41821616-41821638 TCAGGAACACACATGAAGTGTGG - Intronic
1179793344 21:43768214-43768236 ACATGTGCACCCCTGGAGTGTGG + Intergenic
1179877685 21:44279299-44279321 AATTGGACACCCATGGAGTAGGG + Intergenic
1179892783 21:44345361-44345383 ACATGGCCTCCCAAGGAGTGAGG + Intergenic
1180592436 22:16952649-16952671 ACATACACACACATAGAGAGAGG - Intergenic
1183888616 22:40906434-40906456 AAATGCACACACATATAGTGTGG + Intronic
1183915713 22:41117065-41117087 AAATAGAAAAACATGGAGTGAGG + Intronic
1184360701 22:44016433-44016455 ACATGGACACACAGAGAGTGAGG - Intronic
1184936130 22:47723367-47723389 ACACACACACACATAGAGTGAGG + Intergenic
1185150322 22:49160518-49160540 ACAGGGTCACACCTGGAGAGAGG - Intergenic
1185150333 22:49160557-49160579 ACAGGGTCACACCTGGAGCGGGG - Intergenic
1185150380 22:49160720-49160742 ACAGGGTCACACCTGGAGCGGGG - Intergenic
949233413 3:1778089-1778111 ACTTGGGCACACAAGGAATGAGG - Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950587686 3:13907151-13907173 ACATGGACACATGGGGTGTGGGG + Intergenic
950788168 3:15452712-15452734 ACAGACACATACATGGAGTGGGG + Intronic
951354047 3:21642336-21642358 ACTTGGACACACAAAGAGTGAGG - Intronic
953627056 3:44580064-44580086 ACATGGAGACCAATGCAGTGGGG - Intronic
954381696 3:50222222-50222244 ACATACACACAAATGGGGTGGGG + Intergenic
955623849 3:60895373-60895395 ACATACACACACATACAGTGAGG - Intronic
955721475 3:61885995-61886017 ACATGCACACACAGGGAGAGAGG + Intronic
956145668 3:66188526-66188548 ACATGGAGAGAGAGGGAGTGAGG - Intronic
956253983 3:67264241-67264263 ACACGGACACAAAAAGAGTGAGG - Intergenic
956358815 3:68423768-68423790 ACATGGACAAATATGGGGGGTGG + Intronic
956706318 3:72002173-72002195 ACATGGACACACAAGGAATGAGG - Intergenic
957645489 3:82918819-82918841 ACATGCACACACATTGCGTGGGG + Intergenic
957730482 3:84126583-84126605 CCATGTACACACATAGAGTTTGG - Intergenic
958037791 3:88190477-88190499 ACACAGACACACAAGGAGTGAGG - Intergenic
958566024 3:95811254-95811276 ACATACACACACACGGAGAGTGG + Intergenic
958708011 3:97680390-97680412 TCATGTACACACTTGTAGTGAGG - Intronic
959265658 3:104134078-104134100 ACAGGGACACACATGAGGAGTGG - Intergenic
959883712 3:111474878-111474900 ACATGGAACCCCATGGAGAGAGG + Intronic
960517967 3:118623344-118623366 ACATATACACACAGGGACTGGGG - Intergenic
960564655 3:119120406-119120428 ACATGGACACACATGAGGAGTGG + Intronic
961547892 3:127648377-127648399 ACATGGATACACCTGATGTGTGG - Intronic
961643937 3:128382430-128382452 ACATGGACACACATAGACGTAGG - Intronic
961856018 3:129872250-129872272 TCCTAGACACACTTGGAGTGAGG + Intronic
961880710 3:130059545-130059567 ACATGGACGCACATGAAATTTGG + Intergenic
962983428 3:140511049-140511071 ACATAGACACACATGGTGGGGGG - Intronic
963364799 3:144321253-144321275 ACATGGACACACAAAGAGTGAGG - Intergenic
964354297 3:155835878-155835900 ACGTGGACACACAAAGAGTGAGG - Intronic
965287022 3:166829292-166829314 ACATGGACACACATGAAATTTGG - Intergenic
966223110 3:177570032-177570054 ACATTGACCCACAGGGAGAGGGG - Intergenic
967515348 3:190362159-190362181 ACATGGACACACAAAGAGTGAGG - Intronic
967561093 3:190920595-190920617 ACATGGACACACATGAAATTTGG + Intergenic
968848412 4:3061057-3061079 ACATAGATACACACGGAGTGGGG - Intergenic
971051254 4:22865207-22865229 ACATGGCCAAAGATGGAGTCAGG - Intergenic
971678647 4:29668041-29668063 ACATGAACACACAAAGAGTGAGG - Intergenic
972683289 4:41327649-41327671 ACACGGACACACAAGGAGTGAGG + Intergenic
976316522 4:83664494-83664516 ACACAGACACATGTGGAGTGAGG - Intergenic
976465384 4:85362492-85362514 ACATGGATACATGTGGAGTGAGG + Intergenic
976732180 4:88274081-88274103 ACGAGGACACACAAGGAGTGAGG - Intronic
977033926 4:91925047-91925069 CCATGGGCAGCCATGGAGTGGGG - Intergenic
977049321 4:92107390-92107412 GCAAAGAAACACATGGAGTGTGG - Intergenic
977203099 4:94139993-94140015 ACATGGAAACACAAGGGCTGAGG - Intergenic
978357379 4:107891550-107891572 ACATGGACACACAAGGAGTGAGG + Intronic
980876467 4:138666993-138667015 ATTTGGACACACATGCAGAGAGG - Intergenic
980984864 4:139685306-139685328 GGAGGGACGCACATGGAGTGGGG + Intronic
981482958 4:145256559-145256581 ACATGGACACACATGACATTTGG - Intergenic
982608850 4:157548714-157548736 CCATGGCCACAAATGCAGTGTGG + Intergenic
982699393 4:158642798-158642820 ACGTGGACACACAGGGAGTGAGG + Intronic
982793615 4:159620555-159620577 ACATGGACACACCAAGGGTGAGG + Intergenic
983023563 4:162709568-162709590 ACATGGACGCACATGAAATTTGG + Intergenic
984345346 4:178515566-178515588 ATATGTACACACATGAACTGTGG + Intergenic
984436971 4:179720918-179720940 ACATGGACACACATGAAATTTGG + Intergenic
985057643 4:186049268-186049290 ACACGGACACACATGAAATTTGG - Intergenic
985345616 4:189001704-189001726 ACAGGGGCACACATGGAGTGAGG - Intergenic
985390220 4:189484949-189484971 ACATGGACACGCATGAAATTTGG - Intergenic
986212691 5:5689261-5689283 ACATGGAACCACATGGAGTGAGG + Intergenic
986268501 5:6211120-6211142 ACATGGAAACACATGGAGTGAGG + Intergenic
986441017 5:7781833-7781855 TCATGGACACACAAAGAGTGAGG + Intronic
986607768 5:9539195-9539217 AAATGGAAATACATGGTGTGTGG + Intronic
987838760 5:23196139-23196161 AGAAGTACAAACATGGAGTGTGG + Intergenic
988451744 5:31350831-31350853 ACATTGAAATAAATGGAGTGAGG + Intergenic
989659691 5:43786843-43786865 ACATGGACACACATGATATTTGG + Intergenic
989718751 5:44498521-44498543 CCAAGGACAGACATGGAGTCAGG + Intergenic
990158394 5:52906344-52906366 ACATGGACCCATATGATGTGAGG + Intronic
990762980 5:59151072-59151094 ACATGGACACAGGTGGACTAGGG - Intronic
990845784 5:60137002-60137024 GCATGGACACATTGGGAGTGGGG - Intronic
992107495 5:73462072-73462094 ATGTGGACACACAAGGAGTGAGG - Intergenic
992615579 5:78543327-78543349 ACGTGGACACACAAGGAATGAGG - Intronic
992875258 5:81047886-81047908 ACATGCACACACACACAGTGTGG + Intronic
995119337 5:108519400-108519422 ACACGGACACATGTGGAATGAGG - Intergenic
995296574 5:110531316-110531338 ACACGGACACACATGAAATTTGG + Intronic
995492837 5:112710454-112710476 ACATGGACACATCTGGAGGGAGG - Intronic
995899717 5:117051808-117051830 ACATGGACGCACATGAAATTTGG - Intergenic
996385386 5:122905101-122905123 ACATCTACACAGCTGGAGTGTGG - Intronic
996509612 5:124304198-124304220 ACATGGACGCACATGAAATTTGG + Intergenic
996545234 5:124671121-124671143 ACATGAATACACATGCACTGTGG + Intronic
998516167 5:142756141-142756163 ACATGGATACGCTTGGAGGGAGG - Intergenic
998554311 5:143108269-143108291 ACATGTAAACATATGGAATGTGG + Intronic
998620275 5:143786937-143786959 GCATGGACACACATGGAGTGAGG + Intergenic
998727531 5:145034918-145034940 ACATACACACACATGAGGTGAGG - Intergenic
998958551 5:147461508-147461530 ACATGGACACACAAAGAGTAAGG - Intronic
1000580784 5:163033477-163033499 ACAGGGCCTCACATGGAGAGAGG - Intergenic
1000627558 5:163556688-163556710 AGATGGAAACACATGGGGAGAGG + Intergenic
1000832476 5:166120416-166120438 ACATGGACTAACATGGAAAGGGG - Intergenic
1001097143 5:168784382-168784404 ACACAGACACACACAGAGTGGGG + Intronic
1001395032 5:171412579-171412601 ACATGGACAGATATGGATAGAGG - Intergenic
1003514390 6:6805989-6806011 ACAGGGAGACACATGGAGGATGG + Intergenic
1004322990 6:14647664-14647686 TCATGCACACAGATGGGGTGGGG - Intergenic
1004650375 6:17601556-17601578 ACATGGATACAAGTGGAGTTAGG + Intronic
1010587057 6:77665993-77666015 ACATGGACACACATGAAATTTGG - Intergenic
1010829931 6:80515386-80515408 ACATGGACACACATGAAATTTGG - Intergenic
1013211418 6:107990300-107990322 ACATGGACAGATAAGGAGTGAGG - Intergenic
1013315660 6:108940277-108940299 ACATGGACACACATGGAGTGAGG + Intronic
1014952483 6:127573363-127573385 TCATGGCCACACATGTAGAGTGG - Intronic
1016114443 6:140262663-140262685 ACATGGACGCACATGAAATTTGG - Intergenic
1017666790 6:156727002-156727024 ACATTGCAATACATGGAGTGTGG - Intergenic
1017770970 6:157644325-157644347 ACATGGGGACACATGGATGGTGG - Intronic
1018084825 6:160291906-160291928 ACATGGACGCACATGAAATTTGG - Intergenic
1018364233 6:163101623-163101645 CCATAGACAACCATGGAGTGAGG + Intronic
1018405967 6:163482745-163482767 ACATGGATGCACCTGGAGGGTGG - Intronic
1018567022 6:165164833-165164855 ACACAGACACACAAGGAGTGAGG + Intergenic
1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG + Intronic
1019215120 6:170438563-170438585 ACACGGGCACAGATGGAGGGTGG - Intergenic
1019262481 7:89134-89156 ACATAGACACACATGGCCTTGGG - Intergenic
1019903169 7:4040480-4040502 ACCCGGACACACAAGGAGTGAGG + Intronic
1020315734 7:6904185-6904207 ACATGGACGCACATGAAATTTGG + Intergenic
1020459576 7:8413290-8413312 CCATAGCCACACATGGAATGAGG + Intergenic
1020624568 7:10561592-10561614 ATGTGGACACACAGAGAGTGAGG + Intergenic
1021273084 7:18616254-18616276 ACATGGACATCTTTGGAGTGGGG + Intronic
1021820984 7:24497321-24497343 ACACGGACACATGTGGAGTGAGG - Intergenic
1022081118 7:27022488-27022510 ACATGGATACACAATGAGTGAGG + Intergenic
1022544790 7:31175979-31176001 ACATGTAAACACATACAGTGCGG - Intergenic
1023278820 7:38548586-38548608 TTATGAACACACAAGGAGTGAGG + Intronic
1023344698 7:39259608-39259630 ACAGGGACACACAGGGAGCCTGG + Intronic
1023889418 7:44381788-44381810 AGATAGGCACACATGGGGTGTGG - Exonic
1024330004 7:48146267-48146289 ACATGGACACGCATGAAAGGAGG - Intergenic
1025814725 7:64900917-64900939 ACATGGACACACACAGAGTTAGG - Intronic
1026230919 7:68483339-68483361 ACATTGACACACATGTTGGGAGG - Intergenic
1026349288 7:69501743-69501765 ACATGGACACAAAAGGAGTGAGG - Intergenic
1027288295 7:76673342-76673364 ACATGGACACGCGAAGAGTGAGG + Intergenic
1027414285 7:77958579-77958601 ACATGGAGCCTCCTGGAGTGTGG - Intergenic
1030042777 7:105466978-105467000 CCAGAGACACACATGGAGTTTGG + Intronic
1032009294 7:128332162-128332184 ACATGGAAAGACATGCAGTTAGG + Intronic
1033169782 7:139073429-139073451 ACATGGTTACCCGTGGAGTGTGG - Intronic
1033462902 7:141563512-141563534 ACATGGACACTCAGGGTGTCCGG - Intronic
1033667902 7:143460868-143460890 ACGTGGACACACAAAGAGTAAGG + Intergenic
1033835943 7:145312405-145312427 ACTTGGACACACATAAAGAGTGG + Intergenic
1034993276 7:155561448-155561470 ACATGCACACACATGCCATGTGG + Intergenic
1034998862 7:155595454-155595476 ACATGCACACACAAGGAGTGAGG + Intergenic
1035367390 7:158357956-158357978 ACATGCACACACAAGGGGAGGGG - Intronic
1036129728 8:6097850-6097872 ATGTGGACACACAAGGAGTGAGG + Intergenic
1037603685 8:20420062-20420084 ACATGGACACACAGGGATGGTGG + Intergenic
1038381189 8:27095914-27095936 ACATGGACACATAAGGAATAAGG - Intergenic
1039540004 8:38358424-38358446 CTATGGAAACACATTGAGTGTGG - Intronic
1041177396 8:55210677-55210699 ACGTGGACACACACAGGGTGAGG + Intronic
1041182207 8:55260503-55260525 ACATGGACACACATGGAGTGAGG + Intronic
1041938981 8:63366180-63366202 ACACAGACACACGTGGAGTGAGG + Intergenic
1041962325 8:63632947-63632969 ACAGGGAGACACAGGGACTGAGG + Intergenic
1042748007 8:72128232-72128254 ACATGAACACACAAAGAATGAGG - Intergenic
1042946777 8:74163168-74163190 ACACTAACACACGTGGAGTGGGG - Intergenic
1042949084 8:74182445-74182467 ACATGGGCACATGTGGAGTGAGG + Intergenic
1043273761 8:78367415-78367437 ACACAGTCACACAGGGAGTGAGG + Intergenic
1043356516 8:79419277-79419299 ACATAGATCAACATGGAGTGAGG - Intergenic
1044148799 8:88747417-88747439 ACACGGACACACATGAAATTTGG - Intergenic
1044258903 8:90095430-90095452 ACATGGACGCACATGAAATTTGG - Intronic
1044449884 8:92322446-92322468 ACATGGAGATTCCTGGAGTGTGG - Intergenic
1045029624 8:98122438-98122460 ACATGGACACACTAGGAGGTAGG - Intronic
1046519878 8:115310186-115310208 ACAGGCACACACATAGAGAGAGG + Intergenic
1046641813 8:116739742-116739764 ACACAGAGAAACATGGAGTGTGG - Intronic
1047019344 8:120758308-120758330 ACACTGACACACATGGGTTGAGG + Intronic
1047237094 8:123051489-123051511 ACGTGGACACACACAGAGAGAGG + Intronic
1048095166 8:131284098-131284120 ACATGGACACACCTAGCATGGGG - Intergenic
1048135171 8:131741136-131741158 ACACGGACACACATGAAATTTGG + Intergenic
1048316278 8:133364916-133364938 ATGTGGACACACAAGGAGTGAGG - Intergenic
1048520469 8:135149249-135149271 TCATGCACACACATGGACAGAGG + Intergenic
1049569310 8:143360992-143361014 CCACGCACACACATGCAGTGCGG - Intergenic
1050371285 9:4924004-4924026 ACAGGGTCACAAGTGGAGTGGGG + Intergenic
1051407560 9:16755222-16755244 ACATGGCCTCAAATGGAGGGAGG + Intronic
1051757304 9:20416914-20416936 ACATGAACAAACATGGAGACTGG - Intronic
1051757314 9:20417062-20417084 ACATGTACAAACATGGAGACTGG - Intronic
1051757322 9:20417226-20417248 ACATGTACAAACATGGAGACTGG - Intronic
1052162873 9:25288576-25288598 ACATGGACACGCATGAAATTTGG + Intergenic
1052874915 9:33551399-33551421 AGGTGGAGAGACATGGAGTGGGG - Intronic
1053501105 9:38592924-38592946 AGGTGGAGAGACATGGAGTGGGG + Intergenic
1055198341 9:73625281-73625303 ACGTGAACACACAAGGAGTGAGG + Intergenic
1055348047 9:75357157-75357179 AAATGGACACACATGAAATTTGG - Intergenic
1056451301 9:86719531-86719553 CACTGGACACACATGGGGTGTGG + Intergenic
1057680502 9:97177424-97177446 AGGTGGAGAGACATGGAGTGGGG + Intergenic
1057683630 9:97214950-97214972 ACACGGACACACATGAAATTTGG + Intergenic
1057730931 9:97607569-97607591 ACATGGATACAAAAAGAGTGGGG + Intronic
1058353847 9:104059149-104059171 ACATGGACACAGTTGGAAGGGGG + Intergenic
1059117909 9:111615978-111616000 ACATAGACACACAGGGAGGTGGG + Intergenic
1060190475 9:121589172-121589194 ACATGGATCCACATGGAGAGGGG + Intronic
1060190864 9:121591634-121591656 ATAGGGACCCACATGGAGAGGGG + Intronic
1185961028 X:4545866-4545888 ACATGGACGCACATGAAATTTGG - Intergenic
1186928455 X:14360501-14360523 ACACAGACACACAAGGAGTGAGG - Intergenic
1187086842 X:16050009-16050031 ACATGGACGCACATGAAATTTGG - Intergenic
1187941564 X:24387712-24387734 ACATGGACACACAAGGAGTGAGG + Intergenic
1188158988 X:26777610-26777632 ACATGGACACATGTGGAGTGAGG + Intergenic
1188159715 X:26784493-26784515 ACATGAACACATGTGGAGTGAGG + Intergenic
1188557421 X:31428315-31428337 ACATGGTGAGAGATGGAGTGAGG - Intronic
1188641491 X:32510969-32510991 ACATACACACACATAGAGAGAGG - Intronic
1188755483 X:33956265-33956287 ACATGGACACCCAAAGGGTGAGG + Intergenic
1188849707 X:35116552-35116574 ACGTGGACACACAAAGAATGAGG - Intergenic
1188973482 X:36645992-36646014 ATGTGGACACACAAGGAGTGAGG - Intergenic
1190740407 X:53284748-53284770 ACCTGGTCACACATGGTGGGGGG + Intronic
1190944617 X:55079444-55079466 ACATGGGCACACCAAGAGTGAGG - Intergenic
1190945860 X:55093377-55093399 ACATGGGCACACCAAGAGTGAGG - Intronic
1190964408 X:55284758-55284780 ACATGGGCACACCAAGAGTGAGG - Intronic
1192216250 X:69161366-69161388 AGATGGACACACACGGCTTGTGG + Exonic
1193276082 X:79589903-79589925 GCAGTGAGACACATGGAGTGTGG + Intergenic
1193842621 X:86426284-86426306 GAGAGGACACACATGGAGTGGGG - Intronic
1193996543 X:88372338-88372360 ACATTTACCCACATGGAGTTAGG - Intergenic
1194386097 X:93256861-93256883 ACACCGACACACAAAGAGTGGGG - Intergenic
1194546290 X:95239195-95239217 AAATGGCCACCCATGGAGGGAGG + Intergenic
1194616487 X:96110194-96110216 ATGTGGACACACAAAGAGTGAGG + Intergenic
1195972119 X:110484250-110484272 ACATGGACACATGTGGGGTGGGG + Intergenic
1196303396 X:114071892-114071914 ACGTGGACACACCAAGAGTGAGG - Intergenic
1196330496 X:114467106-114467128 ACATGGACACACATGAAATTTGG + Intergenic
1196342067 X:114606787-114606809 ACACGGACACACATGAAATTTGG - Intronic
1196874023 X:120140794-120140816 ACATGGACACACACGTGGAGTGG - Intergenic
1197064600 X:122222439-122222461 ACATGGACGCACATGAAATTTGG + Intergenic
1198573187 X:137980355-137980377 ACATGGAGAAACATGTAGAGAGG + Intergenic
1199141474 X:144318755-144318777 AAATGGACACATGTGGAGTGGGG + Intergenic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic