ID: 1013315682

View in Genome Browser
Species Human (GRCh38)
Location 6:108940444-108940466
Sequence ACCTGGTCCAACCAATCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 53, 1: 91, 2: 79, 3: 86, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013315682_1013315688 8 Left 1013315682 6:108940444-108940466 CCCAAAGATTGGTTGGACCAGGT 0: 53
1: 91
2: 79
3: 86
4: 204
Right 1013315688 6:108940475-108940497 TACATAGCACGCAGGGAAGGTGG 0: 1
1: 0
2: 6
3: 18
4: 143
1013315682_1013315687 5 Left 1013315682 6:108940444-108940466 CCCAAAGATTGGTTGGACCAGGT 0: 53
1: 91
2: 79
3: 86
4: 204
Right 1013315687 6:108940472-108940494 GTTTACATAGCACGCAGGGAAGG 0: 1
1: 18
2: 26
3: 50
4: 122
1013315682_1013315686 1 Left 1013315682 6:108940444-108940466 CCCAAAGATTGGTTGGACCAGGT 0: 53
1: 91
2: 79
3: 86
4: 204
Right 1013315686 6:108940468-108940490 TGATGTTTACATAGCACGCAGGG 0: 1
1: 9
2: 25
3: 49
4: 145
1013315682_1013315685 0 Left 1013315682 6:108940444-108940466 CCCAAAGATTGGTTGGACCAGGT 0: 53
1: 91
2: 79
3: 86
4: 204
Right 1013315685 6:108940467-108940489 GTGATGTTTACATAGCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013315682 Original CRISPR ACCTGGTCCAACCAATCTTT GGG (reversed) Intronic
906008796 1:42503435-42503457 ACCTAGTTGAACCAATCTGTAGG - Intronic
906334030 1:44912876-44912898 ATCTGGTCAAACCACTGTTTTGG - Intronic
906581656 1:46940176-46940198 ACCTGGTGTGTCCAATCTTTTGG + Intronic
906602062 1:47138722-47138744 ACCTGGTGTGTCCAATCTTTTGG - Intronic
909470607 1:76023716-76023738 ACTTGGTCCAACCAATCCTATGG - Intergenic
909800283 1:79797565-79797587 ACCTGGTCAAACCAATCCCCTGG - Intergenic
911648720 1:100363040-100363062 ACCTGGTTGAACCAATCTGCGGG - Intronic
911957887 1:104261240-104261262 ACCTGGTCTGACCAATCTCTGGG + Intergenic
912795846 1:112693079-112693101 CCCTGCTCCAACACATCTTTGGG - Intronic
912938374 1:114023528-114023550 ACTTGGTCCAACCAATCTGTGGG + Intergenic
913667100 1:121058439-121058461 ACCTGGTCCAACCAATCTTTGGG - Intergenic
914018792 1:143845591-143845613 ACCTGGTCCAACCAATCTTTGGG - Intergenic
914657344 1:149753794-149753816 ACCTGGTCCAACCAATCTTTGGG - Intergenic
916042816 1:160975919-160975941 ACCTGGTCCAACCAATCTTTGGG - Intergenic
917956398 1:180103102-180103124 ACCTGGTGGAACCAATCTGTGGG - Intronic
918264418 1:182827932-182827954 ACCAGTTCTAACCAGTCTTTCGG + Intronic
918460486 1:184771478-184771500 ACCTGGTGGAACCAATCTGTGGG + Intergenic
918625486 1:186652109-186652131 ACCTGATCCAACCAATCTTTGGG + Intergenic
918912475 1:190591652-190591674 ACCTGGTCCAACCAATGTTTGGG - Intergenic
919047810 1:192475634-192475656 ACCTGATCAAACCAATCTTTGGG + Intergenic
919368069 1:196690761-196690783 ACCTAGTTTAACCAATCTTTGGG - Intronic
919380844 1:196858930-196858952 ACCTGGTCCAATCAATCTTTGGG - Intronic
920957434 1:210632428-210632450 ACCTGGTCCAACCAATCTTTGGG - Intronic
921413764 1:214866939-214866961 ACCTGGTTGAACCAATCTGTGGG + Intergenic
921836335 1:219782538-219782560 ACCTGGTCCAACCAATCTTTGGG + Intronic
921987937 1:221332939-221332961 ACCTGATCCAACCAATCTGCAGG - Intergenic
922212578 1:223497160-223497182 ACCTGGTCCAACCAATCTGTGGG + Intergenic
923246734 1:232139496-232139518 ACCTGGTCAAACCAATCCCCTGG - Intergenic
923388189 1:233486707-233486729 CCTTGGTCCAACCTAACTTTCGG + Intergenic
923699718 1:236288282-236288304 ACCTGATCCGTCCAATCTGTGGG + Intergenic
923823246 1:237471022-237471044 ACCGAGTCCAACCAATCTTTGGG - Intronic
1063020250 10:2119784-2119806 ACGTGGTCCAACCAATCTTTGGG - Intergenic
1063689802 10:8276016-8276038 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1063740131 10:8808150-8808172 ACCTGGTCAAACCAATCTCTGGG - Intergenic
1063820095 10:9824931-9824953 ACCTGTTCCAACCAATCTGTGGG - Intergenic
1063827268 10:9911710-9911732 ACCTGGTTCGACGGATCTTTTGG + Intergenic
1063852946 10:10213688-10213710 ACCTGGTCTAATCAATCTTTGGG - Intergenic
1064160757 10:12943687-12943709 ACCTGGTCTGACCAGTCTTCTGG + Intronic
1064215934 10:13400681-13400703 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1064469965 10:15626125-15626147 ACCTGGTCCAACCAATCTTTGGG + Intronic
1064773839 10:18753445-18753467 ACCTGGTCTGACTAATCTTTTGG + Intergenic
1064831867 10:19477763-19477785 ACCTGGTCCGACCAATCTCTTGG - Intronic
1064953207 10:20877765-20877787 GCCTGGTCCAACCAATCTGTGGG + Intronic
1065442199 10:25764146-25764168 ACCTGGTCCAACCTATCTTTGGG + Intergenic
1065462588 10:25984443-25984465 ACCTGGTCAAACCAATCCCCTGG + Intronic
1065502404 10:26395078-26395100 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1068135141 10:52945689-52945711 AACTGGTCCAAGCAAGCATTAGG + Intergenic
1068162655 10:53285759-53285781 AGCTGGTCAAAGCATTCTTTTGG + Intergenic
1068423065 10:56821558-56821580 ACCTGGTCCAACCAATCCTCTGG + Intergenic
1068578227 10:58708604-58708626 ACCTGGTCCAACCAATCTTCGGG - Intronic
1068601414 10:58960911-58960933 ACCTGGTTGAACCAATCTGTGGG + Intergenic
1069236891 10:66087155-66087177 ACCTGGTCAAACCAATCCCCTGG + Intronic
1070182312 10:74026012-74026034 ACCTGGTCCAACCAATCTTTTGG - Intronic
1070461165 10:76671912-76671934 ACCTGGTGGAACCAATCTGTGGG - Intergenic
1071418098 10:85459851-85459873 ACCTGGTCCAACCAATCTTTTGG + Intergenic
1071961727 10:90813887-90813909 ACCTGGTCCAACCAATCTATGGG + Intronic
1072120671 10:92403092-92403114 ACCTGGTCTGACCAATCTCTTGG + Intergenic
1072373106 10:94785957-94785979 ACCTGATTGAGCCAATCTTTGGG + Intronic
1072388183 10:94954331-94954353 ACCTGATTAAACCAATCTCTGGG + Intronic
1072404189 10:95134169-95134191 CCCTGGTCCAACCAATCTGTGGG - Intergenic
1073893955 10:108132486-108132508 ACTTTGTCCAACCAGTCTTTGGG - Intergenic
1074311854 10:112329182-112329204 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1074623262 10:115149089-115149111 ACCTGGTCCAACAAATCCTCTGG - Intronic
1074633859 10:115290824-115290846 ACCTGGTCAGATCAATCTTTTGG - Intronic
1074691698 10:116011514-116011536 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1074870553 10:117572436-117572458 CACTGGTTCATCCAATCTTTGGG + Intergenic
1075107156 10:119547842-119547864 ATCTGATCTAACCAATCTGTGGG - Intergenic
1078268417 11:9772499-9772521 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1078546598 11:12251665-12251687 ACCTGGTCCCACCTTTCATTAGG - Intronic
1079501409 11:21105368-21105390 ATCTGGTTCAACCAGTCTTTTGG - Intronic
1079805108 11:24921308-24921330 ACCTGGTCAAACCAATCCCCTGG - Intronic
1080249380 11:30215891-30215913 ACTTAGTCCAACCAATCTTTGGG - Intergenic
1080449276 11:32365280-32365302 GCCTGGTCCAACCAATCTTTGGG - Intergenic
1080725657 11:34897850-34897872 ACCTGGTCAAACCAATCCCCTGG + Intronic
1080935474 11:36858450-36858472 ACCTGGTCAAACCAATCCTCTGG + Intergenic
1082120961 11:48379236-48379258 AGCTGGTCCAACCAACCTTTTGG - Intergenic
1082252883 11:50001413-50001435 AGCTGGTCCAATCAATCTTTTGG + Intergenic
1083591382 11:63897277-63897299 CCCTGGTCCAACAGATATTTTGG - Intronic
1085458364 11:76678449-76678471 ACCTGGTCAAACCTGTGTTTTGG - Intergenic
1085466412 11:76726738-76726760 ACCTTGTCCACCTAATCTTGAGG + Intergenic
1086058487 11:82675953-82675975 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1086954352 11:92920430-92920452 ACTTGGTCAAATCAATCTTTAGG - Intergenic
1087340332 11:96897788-96897810 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1088041523 11:105390116-105390138 ACCTGGTCCAACCAATCTTTTGG - Intergenic
1088099781 11:106142744-106142766 ACCTGGTCAAACCAATCTGTGGG - Intergenic
1088799862 11:113295801-113295823 ACCTGATCGAACCAATCTGTGGG + Intergenic
1090386272 11:126359095-126359117 AACTGGTCCCAGCACTCTTTGGG - Intronic
1092336426 12:7638298-7638320 GCCTGGTCAAACCAATCTCCTGG + Intergenic
1092337505 12:7646295-7646317 ACCTGGTCAAACCAATCCCTTGG + Intergenic
1092338185 12:7652348-7652370 GCCTGGGCTAACCAATCTTCTGG + Intronic
1093818826 12:23585947-23585969 ACCTGGTCAATCCAATCTCCTGG + Intronic
1094248218 12:28327498-28327520 ACCTGGTCCAACCAATCTTTGGG + Intronic
1094476412 12:30844040-30844062 ACCTGTTCAAACCAATCCCTTGG + Intergenic
1094477281 12:30850936-30850958 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1094596586 12:31871786-31871808 ACCTGGTCTAACCAATCTTTGGG - Intergenic
1094712995 12:32984234-32984256 ACCTAGTCTAGCCAATCTCTGGG + Intergenic
1094740289 12:33281064-33281086 ATCTGGTTGAACCAATCTGTGGG + Intergenic
1095404836 12:41856457-41856479 ACCTGGTCCAACCAGTCTGTGGG + Intergenic
1096896253 12:54823090-54823112 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1097400012 12:59117284-59117306 ACCTGGTTAAACCAATCTGTGGG + Intergenic
1097803793 12:63943780-63943802 ATCTGGGCCAACCAACATTTAGG + Intronic
1100189633 12:92176864-92176886 CCCTGGTCAAACCAATCCATGGG + Intergenic
1100363249 12:93897114-93897136 ACCTGGTCCAACCAACCTTTGGG - Intergenic
1102067193 12:109986800-109986822 ACCAGGCCCAGCTAATCTTTTGG - Intronic
1103126528 12:118427556-118427578 ACCTGCTCCCACCTCTCTTTGGG + Intergenic
1103139222 12:118534267-118534289 ATCTGGTCCAACCAATCTTTGGG + Intergenic
1103236594 12:119378087-119378109 ACCTGGTCCGACTGATCTCTCGG - Intronic
1104303981 12:127592741-127592763 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1104346576 12:128005067-128005089 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1105924804 13:24998275-24998297 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1105928522 13:25031124-25031146 ACATGGTCCACACAACCTTTAGG - Intergenic
1106565932 13:30884706-30884728 ACTAGGTCCAACCAATCTTTGGG - Intergenic
1106630651 13:31468301-31468323 ACCTGGCCCAACCAATCCTCTGG - Intergenic
1107117457 13:36762398-36762420 ACCTGATTGAACCAATCTGTGGG - Intergenic
1107871594 13:44751417-44751439 ACCAGGGGCATCCAATCTTTTGG + Intergenic
1109253490 13:60049529-60049551 CCCAGGTCTAACCAATGTTTAGG - Intronic
1109271594 13:60261710-60261732 ACCTGGTCTGACCAATCTTTTGG - Intergenic
1109660898 13:65458876-65458898 ACCTGGTCCAACTAATCTATGGG - Intergenic
1109807760 13:67466772-67466794 ACCTGGTCTGACCAATCTCTTGG - Intergenic
1109985912 13:69984534-69984556 ACCTGGTCCAACCAATCTTTGGG + Intronic
1110028976 13:70581143-70581165 ACCTGATCCAATTAGTCTTTGGG + Intergenic
1110059368 13:71022138-71022160 ACCTGATGGAACCAATCTCTGGG - Intergenic
1110636105 13:77768472-77768494 ACCTGGTCCAACCAATCCCCTGG + Intergenic
1111343512 13:86918874-86918896 ACCTAGTCCAACCAGTTTTGGGG - Intergenic
1111530174 13:89526389-89526411 ACTTGATCCAACCAATTTTTGGG - Intergenic
1111552896 13:89838910-89838932 ACCTGGTCAAACCAATCAGCTGG + Intergenic
1111577541 13:90176042-90176064 ACCTGGTCCAACCAATCTGTGGG + Intergenic
1112082054 13:95982525-95982547 ACCTGCTCCAACCAATTTGTGGG + Intronic
1112170354 13:96966693-96966715 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1112170927 13:96970926-96970948 ACCTGGTCAAACCAATCCGCTGG + Intergenic
1112286076 13:98105549-98105571 ACCTGGTTCAACCAATCTTTGGG + Intergenic
1112673689 13:101672606-101672628 ACCTGATCCAATCAATCTGTGGG + Intronic
1113011103 13:105766616-105766638 ACCTGGGCTAACCAATTCTTGGG - Intergenic
1115799029 14:36971513-36971535 ACCTGGTCAAGCCAATCTGCGGG + Intronic
1117416381 14:55500346-55500368 ACCTGGTCCAACCAATCTTCGGG + Intergenic
1117491837 14:56255722-56255744 ACCTGATCACACCAATCTGTGGG - Intronic
1117868583 14:60174627-60174649 ATCTGGTCCAACCAATCTGTGGG + Intergenic
1117976369 14:61300954-61300976 ACCTGGTCCAACCGATCTTTGGG + Intronic
1119268836 14:73283271-73283293 ATCTAGTCCAACTATTCTTTAGG + Intronic
1122046942 14:99030511-99030533 AGCTGGGCCAACAAATCCTTTGG - Intergenic
1122646980 14:103201378-103201400 ACCTGGTTGAACCAATCTGTGGG - Intergenic
1123149125 14:106164729-106164751 ACCTGGTCCAGCCTCTCTCTTGG + Intergenic
1123977488 15:25566971-25566993 AACGGGTCCAACCAATCTTTGGG + Intergenic
1125087566 15:35748160-35748182 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1126431964 15:48595854-48595876 AACAGGTCCAACAGATCTTTAGG + Intronic
1126885972 15:53150448-53150470 ACCTGGTCTGACCAATCTCTTGG + Intergenic
1128621464 15:69154212-69154234 ACCTGGTCAAACCAGAGTTTAGG - Intergenic
1129914602 15:79257718-79257740 ACCTGGTCAAACCAATCTGTGGG + Intergenic
1130057133 15:80536309-80536331 ACCTGGTCCAACCAATCTTCAGG - Intronic
1131006943 15:88986108-88986130 ACCTGGTCCAACCAATCCCCTGG - Intergenic
1133362824 16:5187489-5187511 ATCTGGTCCAACCAATCTTTGGG - Intergenic
1134001659 16:10787586-10787608 CCCCGGTCCAACCAATCTGTGGG + Intronic
1134386667 16:13779864-13779886 ACCTGATCCAACCAATCTGTGGG + Intergenic
1134567265 16:15262374-15262396 ACCTGGTGCAACCAATCTTTGGG - Intergenic
1134606700 16:15577001-15577023 ACCTGCTCCAACCAATCTGTGGG - Intronic
1134735226 16:16494326-16494348 ACCTGGTGCAACCAATCTTTGGG + Intergenic
1134932295 16:18217891-18217913 ACCTGGTGCAACCAATCTTTGGG - Intergenic
1135683453 16:24478653-24478675 ACCTGGTCCAACCAATCTGTGGG + Intergenic
1136534604 16:30892574-30892596 ACCTGGTCCTACCTCTCTCTTGG + Exonic
1136681095 16:31962833-31962855 ACCTGGTCCAGCCTCTCTCTTGG - Intergenic
1136781410 16:32904345-32904367 ACCTGGTCCAGCCTCTCTCTTGG - Intergenic
1136888386 16:33949495-33949517 ACCTGGTCCAGCCTCTCTCTTGG + Intergenic
1138727175 16:59152582-59152604 GCCTGGTCCAACCAATCTTTGGG - Intergenic
1138746392 16:59367682-59367704 ACCTGATTGAACCAATCTGTGGG + Intergenic
1138898594 16:61240947-61240969 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1139167166 16:64580837-64580859 ACCTGGTCAAACCAATCTCCTGG + Intergenic
1140426762 16:74867628-74867650 ACCTGGTCCACCCTATCCGTGGG + Intergenic
1141412687 16:83846149-83846171 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1203084063 16_KI270728v1_random:1168327-1168349 ACCTGGTCCAGCCTCTCTCTTGG - Intergenic
1143326136 17:6099715-6099737 ACCTGGTCAAACCAATCCCCTGG + Intronic
1143370776 17:6437721-6437743 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1144272965 17:13637055-13637077 ACCTGGTCCAAGCAAACTCTGGG - Intergenic
1146596545 17:34174153-34174175 ACCTGGTCCAACCAATCTGTGGG - Intronic
1147314476 17:39612939-39612961 GGCTGGTCCCACCCATCTTTGGG - Intergenic
1149041783 17:52198633-52198655 ACCTGCTCCAATCAATCTTTGGG - Intergenic
1149335153 17:55627780-55627802 ACCAGGTCCAGCTAATTTTTAGG + Intergenic
1150686123 17:67322305-67322327 ACCTGATGGAACCAATCTGTGGG + Intergenic
1151080532 17:71324138-71324160 ACCTCGTCCAACCAATCTTTGGG + Intergenic
1151506655 17:74532316-74532338 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1151540372 17:74761735-74761757 ACCTGGTCCTACCCCTCATTTGG + Intronic
1151835085 17:76577500-76577522 ACCTGGTCCAAGCACTCCTAAGG + Intronic
1153615295 18:6928603-6928625 ACCTGATCAGACCAATCTGTGGG + Intergenic
1153992996 18:10416581-10416603 ACCAGGGGCATCCAATCTTTTGG + Intergenic
1154005451 18:10523637-10523659 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1154020258 18:10658378-10658400 GCCTGGTCCGACCAATCTTTTGG - Intergenic
1155448925 18:25943241-25943263 ACCTAATCCAACCAATCTTTGGG + Intergenic
1155769851 18:29682828-29682850 ACTTGGTCCAACCAATCTTTGGG - Intergenic
1155934417 18:31740296-31740318 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1155934985 18:31744430-31744452 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1156437872 18:37153115-37153137 ACTTGGTCCGACCAATCTTTTGG + Intronic
1156715662 18:40006855-40006877 TCCTGGTCCAACCAATCTGTGGG + Intergenic
1157509002 18:48254428-48254450 ACATGGTTGAACCAATCTGTGGG + Intronic
1157847150 18:51014500-51014522 ACCTGGTCGAACCAATCTGTGGG + Intronic
1157918781 18:51695258-51695280 ACCTGCTCCAACCAATCTTTAGG - Intergenic
1159440819 18:68477904-68477926 ACCTGTTCAAACCAATCTGTGGG + Intergenic
1159676305 18:71287882-71287904 ACTTGGTCCAACCACTCTTTGGG + Intergenic
1159707224 18:71706703-71706725 ACCTGGTCCAACCAATCTTTTGG + Intergenic
1159915661 18:74185363-74185385 ACCTGGTCCAACCAATTTTTGGG - Intergenic
1161826933 19:6574030-6574052 ACCTGGTCGAACCAATCTGTGGG - Intergenic
1161873064 19:6885560-6885582 ACCTGGTCCAACTAATCTTTGGG + Intergenic
1161878354 19:6929355-6929377 ACTGGGTCCAACCAATCTTTGGG - Intronic
1162864807 19:13537754-13537776 ACCTGGTCCAACCAATCCTTGGG + Intronic
1163047685 19:14656526-14656548 ACCTGGCCCAACCAATCTGTGGG - Intronic
1163050060 19:14676282-14676304 ACCCAGTCCGACCAATCTCTCGG - Intronic
1163061016 19:14761817-14761839 ACCTGTTCCAACCAATCTTTGGG + Intronic
1163070611 19:14837618-14837640 ACTTGGTCCAACCAATCCCCTGG + Intergenic
1163227747 19:15976799-15976821 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1163227807 19:15977295-15977317 TCCTGGTCCAACCAACCTTTGGG - Intergenic
1164186887 19:22878344-22878366 ACCTTGTCTGACCAATCTTTTGG + Intergenic
1164321679 19:24153724-24153746 ACCTGATCCAACCAATGTTTGGG + Intergenic
1164397285 19:27877277-27877299 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1164398333 19:27885644-27885666 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1164763666 19:30746621-30746643 ACCTGGTCCAGCCAATCTTTGGG - Intergenic
1165172397 19:33903288-33903310 ACCTAGTCCAACCAATCTTTGGG - Intergenic
1165975311 19:39671307-39671329 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1166917498 19:46205494-46205516 AGCTGATCCAACCAATCTGTGGG + Intergenic
1168439463 19:56351448-56351470 ACCTGGTCAAGCCAATCCTTTGG + Intronic
1168444258 19:56398207-56398229 ACCTGGTCCAACCAATCTTTGGG - Intronic
926380724 2:12286563-12286585 ACTTGGTCCAACCAATCTTTGGG - Intergenic
926829714 2:16948184-16948206 ACCTGGTTGAACCAATTTGTGGG - Intergenic
928863375 2:35887365-35887387 ACCTGGTTCAACCAATCTGTGGG + Intergenic
929270321 2:39964624-39964646 ACTTGGACCAACCAATCCGTGGG - Intergenic
930494618 2:52125801-52125823 ACCTGGTCCAACCAATCTGTGGG - Intergenic
930621767 2:53651546-53651568 AATTGGTCCAACCAATCTGTGGG + Intronic
930622002 2:53653227-53653249 ACGTGGTCCAACCAATCTGTGGG - Intronic
931448512 2:62347599-62347621 ACCTGGTCCAACCAATCTGTGGG - Intergenic
932295403 2:70620245-70620267 ACCTGGTCCGACCAATCTTTTGG + Intronic
932928735 2:76008246-76008268 ACCAGGTCCAACCAATCTGTGGG + Intergenic
933406641 2:81868409-81868431 TACTGGTCCAAGCAAGCTTTAGG + Intergenic
933659767 2:84917813-84917835 ACCTGGTCCAACCAATCTGTGGG - Intergenic
935139183 2:100336946-100336968 ACCTGGTCAAACCAACCTCCTGG + Intergenic
935364496 2:102275193-102275215 ACCTGGTCCAACCAATCTGTGGG + Intergenic
935715308 2:105934097-105934119 ACCTGGTCAAACCAATCTGGGGG - Intergenic
935723289 2:105998428-105998450 ACCTGGTCCAACAAATCTTTTGG + Intergenic
935782598 2:106521160-106521182 ACCTGGTCCAACCAATCTGTGGG - Intergenic
935850846 2:107217120-107217142 ACCTGGTCCAATGAATCTGTGGG + Intergenic
936229621 2:110688733-110688755 ACCTGGTCAAACCAATCCCCTGG + Intergenic
936626562 2:114155342-114155364 ACCTGGTCCAACCAATCTTTGGG + Intergenic
937163299 2:119786910-119786932 ACCTGGTCCTACCTGGCTTTAGG + Intronic
937486506 2:122320736-122320758 CCCAAGTCCAACCACTCTTTCGG + Intergenic
939131669 2:138242842-138242864 ACCTGATCCAACCAATCTGTGGG - Intergenic
939353255 2:141068418-141068440 ACCTGGTCCGACCAATCTTTGGG - Intronic
939477693 2:142707553-142707575 ACCTGGTCAAACCAACCCCTGGG - Intergenic
939844061 2:147221959-147221981 AGCTGGTCCAACCAATCTTTGGG + Intergenic
940486554 2:154303298-154303320 ACCTGATCCAACCATTCTGTGGG - Intronic
942065231 2:172264669-172264691 ACCGGGTTGAACCAATCTGTGGG - Intergenic
943127060 2:183806815-183806837 ACCTGGTCCAACCAATCTTTGGG + Intergenic
943283123 2:185963325-185963347 ACTTGGTCAAACCAATCCTGTGG - Intergenic
943984499 2:194602961-194602983 ACCTGGTCGAATCAATCTGTGGG + Intergenic
943985329 2:194611219-194611241 ACCTCGTCAAACCAATCTGTGGG + Intergenic
945318794 2:208397674-208397696 ACCTGGTCAAACCAATCCTCTGG - Intronic
945602159 2:211881639-211881661 AACTGGTCTAACCAGTTTTTCGG + Intronic
945936460 2:215907356-215907378 ACCTGGCCCAACCAATCTTTGGG - Intergenic
946863801 2:224024865-224024887 AACTGCACCAACGAATCTTTAGG + Intronic
947282733 2:228473512-228473534 ACCTAATCCAACCAATCCTTGGG - Intergenic
947446013 2:230163135-230163157 ATGTGGTCCAACCAATCTGTGGG - Intergenic
1169846889 20:10003553-10003575 ATCTGGTCCAACCAATCTGTGGG - Intronic
1169948561 20:11015804-11015826 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1169988494 20:11473430-11473452 ACCTATTCCAACCCATCTGTGGG + Intergenic
1169992381 20:11517797-11517819 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1170068236 20:12338851-12338873 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1170308930 20:14971714-14971736 ACCTGATCCAACCAATCTTTGGG - Intronic
1170413298 20:16113481-16113503 ACCTGGTTCAACCAATCTCTGGG - Intergenic
1170506856 20:17035454-17035476 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1171367569 20:24636488-24636510 ACCTGGTCCAACCAATCTTTGGG - Intronic
1172261071 20:33565955-33565977 AACTGACCCAACCAATCTTTCGG - Intronic
1172976053 20:38906864-38906886 ACTTTGTCCCACCATTCTTTGGG + Intronic
1173286231 20:41673634-41673656 ACTTGGTCCAACCAACCTTAGGG + Intergenic
1175884800 20:62283711-62283733 CCCTGGACCAACCATCCTTTGGG + Intronic
1176669060 21:9715147-9715169 ACCTGATATAACCAATCTGTGGG - Intergenic
1177549422 21:22600596-22600618 GCATGGTCCAAGCTATCTTTGGG - Intergenic
1177789239 21:25704716-25704738 ATATGGTCCAAACAATATTTTGG + Intronic
1178271493 21:31193984-31194006 ACCTGGTCCAAACAATCTGTGGG + Intronic
1178288973 21:31350249-31350271 ACCAGGTCCAACCAATTTAATGG + Intronic
1178684389 21:34699915-34699937 GCCCAGTCCTACCAATCTTTGGG - Intronic
1179075895 21:38121416-38121438 CCCTGGTCGAACCAATCTCTGGG - Intergenic
1179192535 21:39135687-39135709 ACCTGGTCCCACTGCTCTTTCGG - Intergenic
1181376212 22:22460175-22460197 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1181641914 22:24205891-24205913 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1181682854 22:24507896-24507918 ACCTGGTCAAACCAATCCCCTGG + Intronic
1181718353 22:24752459-24752481 ACCTGGTCCAACCAATCCTCTGG + Intronic
1182670076 22:31988381-31988403 ACCTGGTCAAACCAATCCCCTGG - Intergenic
949115478 3:316008-316030 ACCTGATCGAACCAATCTGTGGG - Intronic
949336487 3:2980826-2980848 ACCTGGTCTATCCAATCTTTGGG - Intronic
949362069 3:3242743-3242765 GCCTGGTCCAACCAATCTCTAGG - Intergenic
949456214 3:4241875-4241897 AACTGGTCCAACCAATCTCTAGG - Intronic
949669181 3:6378499-6378521 ACCTGGTCAAACCAATCCCCTGG + Intergenic
950348418 3:12321714-12321736 ACCTGCTCCCACAAATCTTATGG + Intronic
951742976 3:25944476-25944498 ATCTGGTTCAACCAATCTGTGGG - Intergenic
953760713 3:45684649-45684671 ACCTGGTCAAACCAATCCCTTGG - Exonic
953792719 3:45960499-45960521 GGCTGGTCCACCCAAACTTTGGG + Intronic
953840000 3:46382304-46382326 ACCTGGTCCAACCAGTCTTTTGG + Intergenic
953840236 3:46384204-46384226 ACCTGGTCTGACCAATCTCTCGG - Intergenic
955568619 3:60277615-60277637 ACCTCGTCCAACCAATCTTTGGG + Intronic
956376640 3:68620322-68620344 GCCTGGTCAAACCAATCCTCTGG - Intergenic
957478547 3:80759065-80759087 ACCTGGTCCAACCAATCCATGGG - Intergenic
959500538 3:107101773-107101795 ACCTGGTCCAACCAATCTTTGGG + Intergenic
960842291 3:121972312-121972334 ACCTGGTCCAACCAATCTTTGGG + Intergenic
963893176 3:150658555-150658577 ACCTAGTCCAACCAAACTATGGG + Intergenic
964366127 3:155952521-155952543 ACCTGGTCCAACCAATCTTTGGG - Intergenic
965437551 3:168671350-168671372 ACCTGGTCCAACCAATCTTTGGG + Intergenic
965819053 3:172666367-172666389 ACCTGGTCAAACCAATCCCCTGG + Intronic
965820092 3:172676496-172676518 ACCTGGTCAAACCAATCCCCTGG + Intronic
965820490 3:172679926-172679948 ACCTGGTCAAACCAATCTCCTGG + Intronic
966119430 3:176506034-176506056 ACCTGGTCAAACCAATCCCCTGG - Intergenic
966120654 3:176515362-176515384 ACCTGGTCAAACCAATCCCCTGG - Intergenic
966409472 3:179633511-179633533 ACCTGATCTGAGCAATCTTTTGG - Intergenic
967070109 3:185955593-185955615 ACCTGGTCAAACCAATCTGTGGG - Intergenic
967936287 3:194730525-194730547 ACCTGATTGAACCAATCTGTGGG - Intergenic
968014529 3:195317553-195317575 TCCTGCGACAACCAATCTTTTGG + Intronic
968171993 3:196518209-196518231 ACCTGGTCAAACCAATCCCTTGG + Intergenic
968848385 4:3060879-3060901 GCCTGGTCCAACCAATCTTTGGG + Intergenic
970592299 4:17570081-17570103 ACCTGGTCAAACCAATCTCCTGG - Intergenic
971600503 4:28585687-28585709 TACTGGTCCAAGCAAGCTTTAGG + Intergenic
971969212 4:33600103-33600125 ACTTGGTCCAACCAATCTTTGGG + Intergenic
972053587 4:34771792-34771814 ACCTGGTGGAACCAAGCTGTGGG + Intergenic
972179489 4:36446068-36446090 ACCTGGTTGAACCAATCTGTGGG - Intergenic
972204897 4:36759869-36759891 ACCTGGTGGAACGAATCTGTGGG - Intergenic
972564764 4:40259854-40259876 ACCTGATCAAACCAATCTGTGGG - Intergenic
972744977 4:41923908-41923930 ACCTGGTCCAACCATTCTTTGGG + Intergenic
973887371 4:55336900-55336922 TCCTGCTCCAGCCAATCTTTGGG - Intergenic
974223225 4:59003358-59003380 ACCTAGTCAAACCAATCCCTTGG + Intergenic
974332216 4:60495620-60495642 ACCTGGTCAAACCAATCCCCTGG - Intergenic
974604325 4:64130955-64130977 ACCTGATCAAACCAAACTGTGGG - Intergenic
974914011 4:68157211-68157233 ACCTGGTCAAACCAATCCCCTGG - Intergenic
974946061 4:68530126-68530148 CCCTGGTTCCACCAATCCTTTGG + Intergenic
975019357 4:69467911-69467933 ACCTGGTCAAACCAATCCCCTGG - Intergenic
975264244 4:72343102-72343124 ACCTGGTCCAACTAATCTGTGGG - Intronic
975856392 4:78629473-78629495 ACCTGGTCCAACCAATCTGTGGG - Intergenic
976260990 4:83144584-83144606 AGCTGGTCAAACAAATCTGTGGG + Intergenic
976316495 4:83664317-83664339 ACCTGGTCCAACCAATCTTTGGG + Intergenic
976396935 4:84566046-84566068 ACCTGGTCAAACCAATCCCCTGG - Intergenic
976465406 4:85362673-85362695 ACCTGGCCCAACCAATCTTTGGG - Intergenic
976575564 4:86666731-86666753 ACCTGGTCCAGCCAATCTGTGGG - Intronic
980033078 4:127852923-127852945 ACCTGGTCCAACCAATCCTCTGG + Intergenic
982096928 4:151931733-151931755 ACCTGGTCCAACCAATCTTTGGG - Intergenic
982699414 4:158642974-158642996 ACCTGGTCCAAGCAATCTTTTGG - Intronic
983043157 4:162954427-162954449 ACCTGGTCAAACCAATCCCCTGG - Intergenic
983516059 4:168657859-168657881 ACCTGGTCCAACCAATCTGTGGG + Intronic
984554708 4:181199834-181199856 ATCTGATCCAAGGAATCTTTGGG + Intergenic
985345584 4:189001525-189001547 ACCTGGTCCAACCAATCTTTGGG + Intergenic
985405723 4:189636372-189636394 ACCTGATATAACCAATCTGTGGG + Intergenic
985482713 5:126926-126948 ACCTGGTCCAACCAATCTGTGGG - Intergenic
985790581 5:1925057-1925079 AACTGGTCTAACCAATAATTTGG - Intergenic
986212718 5:5689440-5689462 ACCCGGTCCAACCAATCTTTGGG - Intergenic
986268529 5:6211288-6211310 ACCTGGTCCAACCAATCTTTGGG - Intergenic
986916790 5:12629253-12629275 TCCTGGACCAACCAGGCTTTCGG + Intergenic
986948530 5:13053212-13053234 ACCTGGTCAAACCAATCCCCTGG + Intergenic
987389315 5:17361080-17361102 ACCTGGTCAAACCAATCTGTGGG - Intergenic
988196840 5:28015141-28015163 ACCTGGTCAAACAAATCCTCTGG + Intergenic
988629429 5:32913152-32913174 ACCTAGTCCGACCAATCTCCCGG + Intergenic
988629481 5:32913488-32913510 ACCTGGTCCGACCAATCTCTCGG + Intergenic
989189895 5:38660473-38660495 ACCTGGTCCAACCAATGTTTGGG + Intergenic
990438981 5:55824779-55824801 ACCTGGTTCAACCAATCTTTGGG - Intergenic
991732663 5:69604300-69604322 ACCTGTTCAAACCAACCTGTGGG + Intergenic
991809096 5:70459444-70459466 ACCTGTTCAAACCAACCTGTGGG + Intergenic
991862290 5:71023552-71023574 ACCTGTTCAAACCAACCTGTGGG - Intronic
992069686 5:73137188-73137210 ACCTGATCGAACCAATCTGTGGG - Intergenic
992107484 5:73461976-73461998 ACCTGGTCCAACCAATCTTTTGG + Intergenic
993353401 5:86877261-86877283 ACCTGGTCTGATCAATCTTTTGG + Intergenic
993856835 5:93086917-93086939 ATCTGTGCAAACCAATCTTTTGG + Intergenic
995014200 5:107291512-107291534 ACCTGGGGTATCCAATCTTTTGG + Intergenic
995581293 5:113605928-113605950 AACTGGTTCTACCAATCTCTTGG + Intergenic
995714907 5:115072768-115072790 ACCTGGTCAAACCAATCCCCTGG - Intergenic
995827278 5:116314744-116314766 ACCTGATGGAACCAATCTGTGGG - Intronic
996148301 5:120002555-120002577 ATCTGTTCCCACCCATCTTTAGG + Intergenic
996665674 5:126057304-126057326 ACCTGGTCAAACCAATCCCCTGG - Intergenic
997230870 5:132242069-132242091 ACCTGGTCAAACCAATCCCCTGG + Intronic
997427084 5:133810678-133810700 ACCTGGTCCAACGAATCTTTGGG - Intergenic
997497454 5:134341861-134341883 ACCTGGTCGAACCAATCTGTGGG + Intronic
998073721 5:139219147-139219169 ACCTGGACCCACCTATCTCTGGG + Intronic
999455181 5:151709404-151709426 ACCGAATCCAACCAATCTGTGGG + Intergenic
999589590 5:153130498-153130520 ACCCAGTCCAATCAATCTGTGGG + Intergenic
1000391887 5:160730962-160730984 ACCTGGTTCAGCCATTCTCTGGG + Intronic
1002288368 5:178180724-178180746 ACCTGGTCCAGCCAATCTTTGGG + Intergenic
1002699070 5:181109838-181109860 CCCTGTTCCAATCAGTCTTTGGG + Intergenic
1004368731 6:15033964-15033986 ACCTGATCGAACCTATCTGTGGG - Intergenic
1006051750 6:31350676-31350698 ACCTGGTACAACCAACCTGTGGG - Intronic
1006061516 6:31423692-31423714 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1006121029 6:31806046-31806068 ACCTGTTCCAACAAGTCTGTTGG - Intronic
1006676065 6:35764569-35764591 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1008220075 6:48844454-48844476 ACCTGGTCCAACCAATCCTTTGG + Intergenic
1008258793 6:49339401-49339423 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1008845431 6:55957487-55957509 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1009683741 6:66929488-66929510 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1009770771 6:68140551-68140573 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1009885765 6:69622286-69622308 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1010627166 6:78152670-78152692 ACCTGGTCCAACCAATCTTTAGG + Intergenic
1013039439 6:106418941-106418963 GCCTGGTCCAGCCAATCTTTAGG - Intergenic
1013315682 6:108940444-108940466 ACCTGGTCCAACCAATCTTTGGG - Intronic
1014199274 6:118590557-118590579 ACCTGGTCAAACCAATCCCCTGG + Intronic
1014291815 6:119566954-119566976 ACCTGGTCCAGCCAATCTCTGGG + Intergenic
1014817966 6:125955828-125955850 AGCTAGTCCAACAAATTTTTTGG + Intergenic
1015515588 6:134079765-134079787 ACCTGGTCCAACCATTCTGTGGG + Intergenic
1017177263 6:151516759-151516781 ACCTGGTTGAACCAATCTCTGGG - Intronic
1017780594 6:157712435-157712457 ACCTGCTCCAACCAATCTTTGGG + Intronic
1020521233 7:9189853-9189875 ACTTGGTCGAACCAATTTGTGGG - Intergenic
1020990940 7:15195432-15195454 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1021101333 7:16587985-16588007 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1021820959 7:24497144-24497166 ACCTGGCCCAGTCAATCTTTGGG + Intergenic
1022215752 7:28259362-28259384 ACCTGGTCCAACCAGTCTTTGGG - Intergenic
1022279329 7:28890251-28890273 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1022304833 7:29137366-29137388 ACCTGGTCCAGCCAATCTGTGGG - Intronic
1022974535 7:35545300-35545322 ACCTGGTCCAATTAATCTTTGGG + Intergenic
1023211055 7:37805153-37805175 CCCTAGTCTAATCAATCTTTGGG + Intronic
1023802034 7:43843525-43843547 CCCTGGTCCAACTGATCTTTGGG + Intergenic
1024330121 7:48147097-48147119 ACCTGGTCCAACCAATCTTTTGG - Intergenic
1024752090 7:52478460-52478482 ACCTGGTTCAACCAATCTTTGGG - Intergenic
1024770169 7:52713152-52713174 ACCTGGTGCAACCAATCCCTGGG + Intergenic
1024770484 7:52715851-52715873 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1024924263 7:54596525-54596547 ACCTGATCAAACCAATCTGTGGG + Intergenic
1025153718 7:56584481-56584503 ACCTGGCCCAACCAATCTTTGGG + Intergenic
1025763573 7:64418378-64418400 ACCTGGCTCAACCAATATTTGGG - Intergenic
1025783001 7:64618408-64618430 ACCTGGTCAAACCAATCTCCTGG + Intergenic
1025783838 7:64625975-64625997 ACCTGGTCAAACCAATTTCCTGG + Intergenic
1026097859 7:67361003-67361025 ACCTGGTCCAGTCAATCTCTTGG + Intergenic
1026183301 7:68061185-68061207 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1026211640 7:68311169-68311191 AACTCGTCCAACCAATCTTTTGG - Intergenic
1026214722 7:68338210-68338232 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1026220506 7:68392403-68392425 ACCTGGTCCAAATAATCTGTGGG - Intergenic
1026222416 7:68412018-68412040 ACCTGGTCCAACCAATCTGTGGG + Intergenic
1026274235 7:68862892-68862914 ACCTGGCCCAACCAATCTGTGGG - Intergenic
1026349264 7:69501567-69501589 ACCTGGTCCAACCAATCTCTTGG + Intergenic
1026494884 7:70893533-70893555 ACCTGGTCCAACCAATCTGTGGG - Intergenic
1026594146 7:71720163-71720185 ACCTGGCCGAACCAATATGTGGG + Intergenic
1026618937 7:71933300-71933322 ACCTGATGGAACCAATCTGTGGG + Intronic
1026624888 7:71983051-71983073 ACCTGGTCCAACCAATCTGTGGG + Intronic
1027502384 7:78969252-78969274 ACCTGGTCAAACCAATCCCCTGG + Intronic
1028679189 7:93505956-93505978 ACCTGGTCCAACCAATCTTTGGG + Intronic
1029333889 7:99883598-99883620 ACCTGGTCCAACCAATCCCATGG - Intronic
1029340975 7:99944376-99944398 ACCTGGTCTGACTAATCTCTCGG - Intergenic
1029585377 7:101467426-101467448 ACCTGGTCTGACCAATCTCTCGG - Intronic
1030164961 7:106544818-106544840 ACCTGGTACAACCAATCTTTGGG - Intergenic
1030622096 7:111801232-111801254 ACCTGGTCAAACCAATCCTCTGG + Intronic
1031757221 7:125660223-125660245 ACCTGGTCGAACCAATCTGTGGG + Intergenic
1031913291 7:127539863-127539885 ACCTGGTCCAACCAATCTGTGGG + Intergenic
1034114568 7:148572286-148572308 ACCTGGTTGAACCAATCTGGGGG + Intergenic
1034160448 7:148990605-148990627 ACCTGGTCCAACCCATCTTTGGG + Intergenic
1034180352 7:149132614-149132636 ACCTGGTCCAACCCATCTCTGGG - Intronic
1034482203 7:151330864-151330886 ACCTTGTTGAACCAATCTGTGGG + Intergenic
1036079099 8:5533946-5533968 ACCTGGTCCAACCAATCTTTTGG - Intergenic
1036427686 8:8661294-8661316 ACCTGGTCCGACCAATGTTTTGG + Intergenic
1037216839 8:16464702-16464724 AATGGGTCCAACCAATCTTTTGG + Intronic
1037221558 8:16528784-16528806 GCCTGGTCCAACCAATCTGTGGG - Intronic
1037694165 8:21209040-21209062 ACCTGGTCCAAACAATCTTTGGG + Intergenic
1037940990 8:22950707-22950729 AACTGGTCCAACCAATCTGTGGG - Intronic
1038983700 8:32786276-32786298 AACTGGTCCAATCAATCTGTAGG - Intergenic
1039648029 8:39308183-39308205 ACCTGGTCCAACCAATCTTTGGG + Intergenic
1039650102 8:39332357-39332379 ACCTGATCAAACCAAACTGTGGG - Intergenic
1040401723 8:47057168-47057190 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1040957589 8:52995503-52995525 AGTTGGTCAAACCAATCTGTGGG + Intergenic
1041182231 8:55260685-55260707 ACCTGGTCCAACCAATCTTTGGG - Intronic
1041387367 8:57318764-57318786 ACCTGGTGAAACCAATCCCTTGG - Intergenic
1041597764 8:59677066-59677088 ACCTGGTCCAAACAGTCTTTGGG + Intergenic
1041601094 8:59718038-59718060 ACCTGGTCTAACCAATCTTTGGG + Intergenic
1041939009 8:63366356-63366378 ACCTGGTCCAACCAATATTTGGG - Intergenic
1042397640 8:68310821-68310843 ACCTGGTCCAACCAATCTCTGGG - Intronic
1042411647 8:68473311-68473333 ACCTGGTCCAACCAGTCTTTGGG - Intronic
1042665164 8:71196202-71196224 AGCTGGTCCAACCAATCTGTGGG + Intergenic
1042895849 8:73667039-73667061 ACCTGCTCCAACTACTCTTGTGG + Intronic
1042949107 8:74182626-74182648 ACCTGGTCCAAACAATCTTTGGG - Intergenic
1044301649 8:90591293-90591315 ACCTGGTCCAACCAATCTATGGG + Intergenic
1044448891 8:92310979-92311001 ATGTGGTCCAACCATTTTTTTGG + Intergenic
1044656901 8:94557803-94557825 ACCCGGTCCAACCAATCTGTGGG - Intergenic
1044945298 8:97383675-97383697 ACCTGGTCCAATCAATCTGTGGG - Intergenic
1045777490 8:105822748-105822770 ACCTGGTCTGACCAATCTTTTGG - Intergenic
1045794800 8:106030085-106030107 ACCTGGTTGAACAAATCTGTGGG - Intergenic
1046045621 8:108960886-108960908 ACCTGGTCTGAGCAATCTTTCGG - Intergenic
1046193431 8:110829899-110829921 ACCTGGTCAAAACAATCTCCTGG - Intergenic
1046315870 8:112500955-112500977 ACCTGGTCAAACCAGTCTGTGGG + Intronic
1046320388 8:112566854-112566876 ACCTGGTTCAACTAATCTTTTGG + Intronic
1046488397 8:114915958-114915980 ACCTCGAGCAACCAATCTGTGGG - Intergenic
1047182522 8:122603181-122603203 ACCGGGCCCAACCAGTCTTGTGG - Intergenic
1047238788 8:123066205-123066227 ACCTGGTCCAACCAATCTGTGGG - Intronic
1047445115 8:124912707-124912729 ATCTGGTCCGACCAATCTTTTGG + Intergenic
1050165524 9:2760999-2761021 ACCTGGTCCGACCAATCTTCTGG + Intronic
1050830229 9:10000930-10000952 ACCTGGTCAAACCAATCCACTGG + Intronic
1051636909 9:19189015-19189037 ACCTGGTCCATCCAATCTCTCGG + Intergenic
1052718340 9:32145584-32145606 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1053356465 9:37450043-37450065 ACGTGATCAAACCAATCTGTGGG + Intronic
1055463618 9:76542519-76542541 ACCTGCTCTAACCAATCTTTGGG + Intergenic
1055567830 9:77586692-77586714 ACCTGGTCCAACCAATTTTTGGG - Intronic
1056449080 9:86697874-86697896 ACCTGGGCCAAGCAATCCTTGGG + Intergenic
1056626040 9:88254146-88254168 ATCTGGTCCCACCAGTGTTTGGG + Intergenic
1057918266 9:99074280-99074302 ATCTGGTCAAACCAATCTGTGGG + Intergenic
1058049963 9:100395557-100395579 ACCTGGTCTAACCAATCTGTGGG - Intergenic
1058078009 9:100670091-100670113 ACCTGGTCTAACCAATCTCTTGG - Intergenic
1061247736 9:129409572-129409594 GCCTGGCCGAACCTATCTTTCGG - Intergenic
1203656806 Un_KI270753v1:5788-5810 ACCTGATATAACCAATCTGTGGG + Intergenic
1185992153 X:4903352-4903374 ACCTTGTCCAACCAATGTTTTGG - Intergenic
1186016761 X:5204479-5204501 ACCTGGTCTGACCAATCTCTCGG + Intergenic
1186063812 X:5740022-5740044 ACCTGGTCCGACCAATTTCTTGG - Intergenic
1186353748 X:8768283-8768305 ACCTGGTCCAACCAATCTTTGGG - Intergenic
1188148949 X:26649012-26649034 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1188149545 X:26654452-26654474 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1188181204 X:27058023-27058045 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1188491265 X:30740903-30740925 ACCTGGTCCAACCAATCTGTGGG + Intergenic
1188833876 X:34932903-34932925 ACCTGGTCCAACCAATCTTTTGG + Intergenic
1188964500 X:36535015-36535037 ATCTGGTCCAACCAGTCTCTCGG - Intergenic
1189863700 X:45300789-45300811 ACATGGTCCAACCAATCTTTGGG - Intergenic
1190538791 X:51456501-51456523 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1193700934 X:84760296-84760318 TCATGGTCTAACTAATCTTTGGG - Intergenic
1193772381 X:85603463-85603485 ACCTGGTTGAACCAATCTGTAGG + Intergenic
1193996747 X:88374998-88375020 ACCTGGTCCAACCAATCTGTTGG + Intergenic
1194027160 X:88766828-88766850 ACCTTGGCCACCCAAACTTTTGG - Intergenic
1194104936 X:89757238-89757260 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1194550229 X:95289234-95289256 ACCTGGCCTGACCAATCTCTTGG + Intergenic
1196874000 X:120140609-120140631 ACCTGGTCAAACCAATCCCCTGG + Intergenic
1197076154 X:122355581-122355603 ACCTTGTACAACAAAACTTTGGG + Intergenic
1198837208 X:140817496-140817518 ACCTGGTCAAACCAATCCCTTGG - Intergenic
1198837664 X:140821426-140821448 ACCTGGTCAAACCAATCCTCTGG - Intergenic
1200456900 Y:3405027-3405049 ACCTGGTCAAACCAATCCCCTGG - Intergenic
1201532602 Y:15008641-15008663 ATCTGGTCTGACCAATCTCTTGG + Intergenic