ID: 1013315683

View in Genome Browser
Species Human (GRCh38)
Location 6:108940445-108940467
Sequence CACCTGGTCCAACCAATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 51, 1: 84, 2: 63, 3: 69, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013315683_1013315687 4 Left 1013315683 6:108940445-108940467 CCAAAGATTGGTTGGACCAGGTG 0: 51
1: 84
2: 63
3: 69
4: 117
Right 1013315687 6:108940472-108940494 GTTTACATAGCACGCAGGGAAGG 0: 1
1: 18
2: 26
3: 50
4: 122
1013315683_1013315685 -1 Left 1013315683 6:108940445-108940467 CCAAAGATTGGTTGGACCAGGTG 0: 51
1: 84
2: 63
3: 69
4: 117
Right 1013315685 6:108940467-108940489 GTGATGTTTACATAGCACGCAGG No data
1013315683_1013315686 0 Left 1013315683 6:108940445-108940467 CCAAAGATTGGTTGGACCAGGTG 0: 51
1: 84
2: 63
3: 69
4: 117
Right 1013315686 6:108940468-108940490 TGATGTTTACATAGCACGCAGGG 0: 1
1: 9
2: 25
3: 49
4: 145
1013315683_1013315688 7 Left 1013315683 6:108940445-108940467 CCAAAGATTGGTTGGACCAGGTG 0: 51
1: 84
2: 63
3: 69
4: 117
Right 1013315688 6:108940475-108940497 TACATAGCACGCAGGGAAGGTGG 0: 1
1: 0
2: 6
3: 18
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013315683 Original CRISPR CACCTGGTCCAACCAATCTT TGG (reversed) Intronic