ID: 1013315685

View in Genome Browser
Species Human (GRCh38)
Location 6:108940467-108940489
Sequence GTGATGTTTACATAGCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013315683_1013315685 -1 Left 1013315683 6:108940445-108940467 CCAAAGATTGGTTGGACCAGGTG 0: 51
1: 84
2: 63
3: 69
4: 117
Right 1013315685 6:108940467-108940489 GTGATGTTTACATAGCACGCAGG No data
1013315682_1013315685 0 Left 1013315682 6:108940444-108940466 CCCAAAGATTGGTTGGACCAGGT 0: 53
1: 91
2: 79
3: 86
4: 204
Right 1013315685 6:108940467-108940489 GTGATGTTTACATAGCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013315685 Original CRISPR GTGATGTTTACATAGCACGC AGG Intronic
No off target data available for this crispr