ID: 1013317611

View in Genome Browser
Species Human (GRCh38)
Location 6:108957274-108957296
Sequence CCTTACACAGCTCGACTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013317599_1013317611 8 Left 1013317599 6:108957243-108957265 CCTGACAGGGGGTCACCCCCCTC 0: 1
1: 0
2: 0
3: 8
4: 162
Right 1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1013317603_1013317611 -10 Left 1013317603 6:108957261-108957283 CCCTCCACCTTCCCCTTACACAG 0: 1
1: 0
2: 2
3: 52
4: 670
Right 1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1013317601_1013317611 -8 Left 1013317601 6:108957259-108957281 CCCCCTCCACCTTCCCCTTACAC 0: 1
1: 1
2: 8
3: 112
4: 1370
Right 1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1013317598_1013317611 9 Left 1013317598 6:108957242-108957264 CCCTGACAGGGGGTCACCCCCCT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1013317600_1013317611 -7 Left 1013317600 6:108957258-108957280 CCCCCCTCCACCTTCCCCTTACA 0: 1
1: 1
2: 4
3: 77
4: 953
Right 1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1013317597_1013317611 10 Left 1013317597 6:108957241-108957263 CCCCTGACAGGGGGTCACCCCCC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1013317602_1013317611 -9 Left 1013317602 6:108957260-108957282 CCCCTCCACCTTCCCCTTACACA 0: 1
1: 2
2: 1
3: 79
4: 639
Right 1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013317611 Original CRISPR CCTTACACAGCTCGACTCCT GGG Intronic
901349290 1:8578633-8578655 CCTTCCACTGCTCTACTGCTGGG - Intronic
903846804 1:26283745-26283767 CCTTTCACAGGTGGACACCTAGG + Intronic
904492127 1:30867766-30867788 CCTCAGACAGTTTGACTCCTTGG - Intergenic
911614867 1:99998552-99998574 CCTTTCACAGCTAGACACTTTGG + Intronic
913702873 1:121390508-121390530 CTTGTCACAGCTTGACTCCTAGG + Exonic
916757829 1:167790278-167790300 CCTTCCCCAGCCCGACTTCTTGG + Exonic
917133023 1:171761681-171761703 CCTTACACAGTTTGCCCCCTCGG - Intergenic
920490304 1:206409249-206409271 CTTGTCACAGCTTGACTCCTAGG + Intronic
920813454 1:209308500-209308522 CATTACCCAGCTCTAGTCCTTGG - Intergenic
1067735740 10:48848780-48848802 TCTTTCCCAGCTCGCCTCCTCGG - Intronic
1075119301 10:119652123-119652145 CCGTCCACGGCTCGACTCCAGGG + Intronic
1077870779 11:6259886-6259908 CCTTACTCAGCTCGACCCGGCGG - Exonic
1096779842 12:53985475-53985497 CCTCTCGCAGCTGGACTCCTGGG + Exonic
1097240245 12:57570033-57570055 CCTCACAGAGCTCGGCTCCCAGG - Exonic
1100358372 12:93853567-93853589 CCGTAAACAGCTCTACTGCTTGG - Intronic
1101992312 12:109496496-109496518 CCTCACACAACACTACTCCTGGG - Intronic
1107892034 13:44922340-44922362 CCTTATAAAGCATGACTCCTGGG - Intergenic
1111203648 13:84973950-84973972 CCTTTCCTAGCTCCACTCCTGGG + Intergenic
1114127258 14:19743442-19743464 CCTGATACAGCTAGAGTCCTAGG + Intronic
1114575139 14:23706257-23706279 CCTCACACAGCTTGCCTGCTTGG - Intergenic
1120520796 14:85526099-85526121 CCTTACACTGGTCCACACCTTGG + Intergenic
1121478012 14:94230848-94230870 CATTCCACTGCTCAACTCCTAGG - Intronic
1127133558 15:55895389-55895411 TTTTACACAGCTCAGCTCCTTGG - Intronic
1129113917 15:73354321-73354343 CCTCACACAGCTCACCTTCTTGG - Intronic
1144171185 17:12661444-12661466 CCTTACACATCTCCTTTCCTAGG - Intergenic
1148106053 17:45119598-45119620 CCTTCCACATCTTGATTCCTGGG - Intronic
1150494488 17:65596865-65596887 CGTTGCCCAGCTAGACTCCTGGG - Intronic
1157710373 18:49846010-49846032 CCTTCCCCAGCTGGGCTCCTAGG - Intronic
1160200367 18:76790899-76790921 CCTTTCACAGCACAACTCTTGGG + Intergenic
927683858 2:25157575-25157597 CCCCACACAGCTAGAGTCCTCGG - Exonic
928502227 2:31908660-31908682 CCTTCTACAGCTTGATTCCTTGG - Intronic
938340932 2:130536048-130536070 TCCAACACAGCTCCACTCCTGGG + Intergenic
938348898 2:130584661-130584683 TCCAACACAGCTCCACTCCTGGG - Intergenic
943263678 2:185698192-185698214 CCTAACACAGCATGACTCCTAGG + Intergenic
947243056 2:228017482-228017504 GCTCTCACAGCTCGACTGCTTGG + Exonic
947662938 2:231883511-231883533 AGTGACACATCTCGACTCCTGGG + Intergenic
949063826 2:241977125-241977147 CCTTCCACCGCTCCACTCTTTGG + Intergenic
1172915734 20:38442234-38442256 CCTTTCTCAGCTTGACTTCTTGG + Intergenic
1173322244 20:41998565-41998587 CCTTACTCAGAACCACTCCTCGG + Intergenic
1173526337 20:43735747-43735769 CACTACACAGCTTCACTCCTTGG - Intergenic
1178383135 21:32128262-32128284 CCTTACCCAGCTCAACAACTTGG - Intergenic
1183418761 22:37697829-37697851 CCTGACCCAGCTCCACTCCAGGG + Intronic
1184250078 22:43254999-43255021 CCTTACCCATCTCCACTCCTGGG - Intronic
1184264670 22:43340782-43340804 CCTTGCACTGCTGCACTCCTGGG - Intronic
970600318 4:17636812-17636834 CCTGACAGAGCTGGAATCCTGGG - Intronic
971472667 4:27043517-27043539 CCCTATACAGCTCCACTCGTAGG + Intergenic
984831443 4:183978789-183978811 CCTTACACACTTCGAATCCCTGG - Intronic
999303292 5:150504158-150504180 CCTGGCACAGCTCAACTGCTGGG - Intronic
999696819 5:154194543-154194565 CCTTCCTCAGCTGGACTCCTTGG - Intronic
1004066140 6:12246274-12246296 CCTTCCACAGCCCGCCTCTTAGG + Intergenic
1004078653 6:12369174-12369196 CCTTACACGGCTGTACTCATGGG + Intergenic
1013317611 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG + Intronic
1016822733 6:148361656-148361678 CCTTGCACAGCCCTACACCTTGG + Intronic
1021855181 7:24848170-24848192 CCTCACACACCTTCACTCCTTGG - Intronic
1026528931 7:71180650-71180672 CCTTACACCACTAGACACCTGGG + Intronic
1033605841 7:142928138-142928160 CCTCACGGAGATCGACTCCTGGG - Exonic
1035291907 7:157844603-157844625 CCTTCCACAGCACGACCCCAGGG + Intronic
1037003332 8:13747540-13747562 CCCCACACAGATCGCCTCCTGGG - Intergenic
1037726500 8:21486778-21486800 CCTTGCACAGCTCGCCACTTGGG + Intergenic
1041272579 8:56123492-56123514 ACTTACACTTCTCTACTCCTTGG + Intergenic
1043822079 8:84879126-84879148 TCTTGCACAGCTCATCTCCTAGG - Intronic
1046678068 8:117134471-117134493 CCTCACACTCCTCAACTCCTAGG - Intronic
1048459531 8:134610149-134610171 CCTCACCCAGCTCTTCTCCTGGG - Intronic
1056459908 9:86799670-86799692 CCTTCCACAGCTCTGCTCATTGG + Intergenic
1057444304 9:95103241-95103263 CCTTACACACCAACACTCCTGGG + Intronic
1193871555 X:86805013-86805035 CCTGTCACAGCTCCACTACTAGG + Intronic
1197263926 X:124346597-124346619 CCTTGCACAGTTCTCCTCCTCGG + Exonic
1199837241 X:151603774-151603796 TCTTACCCAACTCTACTCCTAGG + Intronic