ID: 1013317615

View in Genome Browser
Species Human (GRCh38)
Location 6:108957311-108957333
Sequence CTGCTAAGCCCTTTCTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 84}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013317600_1013317615 30 Left 1013317600 6:108957258-108957280 CCCCCCTCCACCTTCCCCTTACA 0: 1
1: 1
2: 4
3: 77
4: 953
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317603_1013317615 27 Left 1013317603 6:108957261-108957283 CCCTCCACCTTCCCCTTACACAG 0: 1
1: 0
2: 2
3: 52
4: 670
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317601_1013317615 29 Left 1013317601 6:108957259-108957281 CCCCCTCCACCTTCCCCTTACAC 0: 1
1: 1
2: 8
3: 112
4: 1370
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317604_1013317615 26 Left 1013317604 6:108957262-108957284 CCTCCACCTTCCCCTTACACAGC 0: 1
1: 1
2: 5
3: 42
4: 489
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317605_1013317615 23 Left 1013317605 6:108957265-108957287 CCACCTTCCCCTTACACAGCTCG 0: 1
1: 0
2: 1
3: 15
4: 215
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317602_1013317615 28 Left 1013317602 6:108957260-108957282 CCCCTCCACCTTCCCCTTACACA 0: 1
1: 2
2: 1
3: 79
4: 639
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317612_1013317615 -3 Left 1013317612 6:108957291-108957313 CCTGGGTGAGTTTCTAAGCCCTG 0: 1
1: 0
2: 1
3: 16
4: 179
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317608_1013317615 15 Left 1013317608 6:108957273-108957295 CCCTTACACAGCTCGACTCCTGG 0: 1
1: 0
2: 0
3: 0
4: 58
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317610_1013317615 14 Left 1013317610 6:108957274-108957296 CCTTACACAGCTCGACTCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317606_1013317615 20 Left 1013317606 6:108957268-108957290 CCTTCCCCTTACACAGCTCGACT 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84
1013317607_1013317615 16 Left 1013317607 6:108957272-108957294 CCCCTTACACAGCTCGACTCCTG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG 0: 1
1: 0
2: 1
3: 15
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013317615 Original CRISPR CTGCTAAGCCCTTTCTACAC TGG Intronic
900424394 1:2569398-2569420 CTGCCAGGCACATTCTACACTGG - Intergenic
905790840 1:40788472-40788494 CTGCTGAGCTCTCTCTAAACCGG + Intronic
906809461 1:48811273-48811295 CTGCTAAGACCATTCAACATTGG + Intronic
908258497 1:62321177-62321199 ATGCTAAACACTTTCTACATAGG + Intergenic
909137641 1:71821544-71821566 CTTCAGAGCCCTTTCTACTCTGG - Intronic
916100367 1:161388985-161389007 CCGCAAATCCCTTTTTACACTGG - Intergenic
918444011 1:184597876-184597898 CTACTGAGCACTTTCTGCACTGG - Intronic
920826590 1:209428727-209428749 CTGCCAGGCCCTTTCTCCATTGG + Intergenic
1065542138 10:26781028-26781050 CTACTAATGCCTTTCTACATGGG - Intronic
1074896569 10:117782368-117782390 CTGCTTAGCCATTTCTACACTGG + Intergenic
1075537816 10:123285796-123285818 TTTCTAAGTCCTTTCTACATAGG - Intergenic
1080312454 11:30910926-30910948 CTGCCAAGGCCTTTATAAACGGG + Intronic
1083101998 11:60318113-60318135 CTGTTAAGCCCTTTATAGACAGG + Intergenic
1084580305 11:70019157-70019179 CTGCTAAACCCCTTCCACAGAGG - Intergenic
1086491800 11:87363268-87363290 CTCCTAAGACCTTTCTAGACAGG - Intergenic
1087482293 11:98717303-98717325 CATTTAAGCTCTTTCTACACTGG + Intergenic
1089854555 11:121531677-121531699 ATGCTAAGCCTTTGTTACACTGG + Intronic
1091326385 11:134691750-134691772 CCGCTAAGCCCTTTCTGACCAGG - Intergenic
1099509991 12:83523150-83523172 CTGCCAACCTCTTTCTACTCAGG - Intergenic
1101114846 12:101522025-101522047 CTCCTAAGCCCTTGCTACATAGG + Intergenic
1104951695 12:132443916-132443938 CTACTTAGCTCTTTCAACACAGG + Intergenic
1108364210 13:49693712-49693734 CTCCTCAGTCCTTTCTACTCTGG + Intergenic
1112075372 13:95907315-95907337 CTGCTAAGCCCTGCCCACACAGG - Intronic
1112316899 13:98370925-98370947 CTGCTAAGCCGGGTCTGCACAGG + Intronic
1119940637 14:78637416-78637438 CTACCAAACCCTTACTACACTGG + Intronic
1121699735 14:95943575-95943597 TTGCTCAGCCCTTTCCACACTGG - Intergenic
1122025373 14:98872058-98872080 CTCCACAGCCCTTTCTACATGGG - Intergenic
1127990634 15:64113433-64113455 CTGCTAAACACTCTGTACACAGG + Intronic
1129794100 15:78362995-78363017 CTGCAGAGCCCTGGCTACACTGG + Intergenic
1130792241 15:87167887-87167909 CACCTGAGCTCTTTCTACACTGG - Intergenic
1132523189 16:400918-400940 CTGCCAGGCCCTTTCTGCGCTGG - Intronic
1134246230 16:12542176-12542198 GTGCTAAGCCTTTTCCACACAGG + Intronic
1135649558 16:24193977-24193999 TCACTAAGCCCTTACTACACAGG - Intronic
1137414925 16:48267229-48267251 CTCCTAAACCATTACTACACAGG + Intronic
1138111956 16:54330888-54330910 CTGATAAGTCATTTCTACAGGGG - Intergenic
1140880268 16:79191832-79191854 CTTCTAAGCCCATTCTTCAATGG + Intronic
1148818787 17:50348345-50348367 CAGCTAAGCCCATTCTCCTCAGG - Intronic
1150146830 17:62776250-62776272 CTGCTAAGACCAATCAACACAGG + Intronic
1151120942 17:71792180-71792202 CTGCTTAGCCCATTTTATACTGG + Intergenic
1154161765 18:11985748-11985770 CCTGGAAGCCCTTTCTACACTGG + Intronic
1157727732 18:49977828-49977850 GTGCTAAAACCTTTCCACACAGG + Intronic
1158489097 18:57894082-57894104 CTGTTCATCCCTTTCTTCACAGG - Intergenic
1161719916 19:5897036-5897058 CTGCTAAGCCCTTGCTTGGCCGG + Intronic
926899354 2:17733291-17733313 TTGCTAAGCCCTTTCTGCTAGGG - Intronic
927285785 2:21355592-21355614 CTGCTAAGCCTTTTCTACCTGGG - Intergenic
930571991 2:53098050-53098072 CTGCTAAGCACTCTCTAAAGTGG - Intergenic
930991398 2:57660171-57660193 CTTCAAACCACTTTCTACACCGG + Intergenic
937766960 2:125672620-125672642 CTCCTAGGCCCTCTCTACATAGG - Intergenic
941438826 2:165507775-165507797 GTGCTCAGCACTTTCTACAGGGG + Intronic
941802099 2:169671338-169671360 CTGCAAAGCCTTCTCTAGACTGG + Intronic
945594786 2:211777994-211778016 AAGCTAAGCCCTTACTAGACTGG + Intronic
1169508778 20:6242083-6242105 CTTCTAAGCCCTTGCTGAACAGG + Intergenic
1175388986 20:58614561-58614583 CTGCTTTGCCCTTTCTTCACAGG + Intergenic
1183090244 22:35517509-35517531 GTGCTAACCCCTTTCTCCAAGGG + Intergenic
1183245472 22:36690056-36690078 CTGCTACGCCCTGTCTGCGCTGG + Intronic
1183256868 22:36768075-36768097 CGGCTAAGCCTTTTATCCACAGG + Intronic
1183976174 22:41513622-41513644 CTGCCAAGTGCTTTCTGCACTGG + Intronic
1184522929 22:45006795-45006817 TTACTAAGCCCTTTTTTCACTGG - Intronic
950097953 3:10340888-10340910 CAGCAAAGCCCTTTCTCCTCTGG + Intronic
950616190 3:14160441-14160463 CGGCCAAGGCCTTCCTACACGGG + Intronic
954820510 3:53322626-53322648 CTGAGAAGCCCTTTGTAAACAGG - Intronic
955361628 3:58281182-58281204 CAGCTAAGCCCTGCCCACACAGG + Intronic
958872766 3:99580469-99580491 CTGCCAAGCCATTTCTACTTAGG - Intergenic
966451328 3:180066207-180066229 ATGCTAAGCCTTTACCACACAGG + Intergenic
969685785 4:8673284-8673306 CTGGTAAGCACTTGCTAAACAGG + Intergenic
975487022 4:74945191-74945213 CTTCTAAACCCTTTCTCCACAGG - Intronic
978343054 4:107737938-107737960 CTGCTAACCTCCTTCTACAATGG + Intergenic
978343235 4:107739323-107739345 CTGCTAACCTCTTTCTACAATGG + Intergenic
979659598 4:123238235-123238257 CAGCTATGCCCTGTCTACAGAGG - Intronic
980669550 4:135986632-135986654 CTGCTAAGCCCTGGTTACAGAGG + Intergenic
989535759 5:42561991-42562013 CTGCCAAGCCCTTTTTGCCCAGG - Intronic
994381608 5:99078509-99078531 CTGCTAAGCCCTTTATATGTTGG + Intergenic
1001306904 5:170581569-170581591 CTGCCAAACCCTTGGTACACAGG - Intronic
1002045951 5:176541963-176541985 CTGCTAAGTCCTTTCCACTCAGG + Intergenic
1004317699 6:14604814-14604836 CAGCTAAGCCCTTGCTACAGTGG + Intergenic
1013317615 6:108957311-108957333 CTGCTAAGCCCTTTCTACACTGG + Intronic
1015250247 6:131120007-131120029 CCCCAAAGCCCTTACTACACTGG - Intergenic
1016005978 6:139090010-139090032 CAGCTATGCCCTTCCTACAGAGG + Intergenic
1016864648 6:148753746-148753768 CTGCCAAGCTGTTTCTACAGTGG + Intronic
1018591164 6:165424057-165424079 CTTCCAGGACCTTTCTACACAGG + Intronic
1022846657 7:34216640-34216662 CTGCTAAACCCTTTCTACTGGGG + Intergenic
1023482012 7:40644624-40644646 ATGCTAAGCCCTTTCATCTCTGG + Intronic
1024231661 7:47368049-47368071 CTGTTAAGCCCATTCTGCAATGG + Intronic
1024417784 7:49127515-49127537 CTGGTAAGCTCTTTCTATAAAGG - Intergenic
1024530945 7:50392333-50392355 TAGCTAAGCCCTGTCTTCACTGG - Intronic
1035361031 7:158314590-158314612 CTCCTGAGCCCTTTCCCCACGGG - Intronic
1036711598 8:11082988-11083010 CTTCCCAGCCCTTTCTGCACAGG + Intronic
1040028614 8:42804130-42804152 CCTCTGAGCCCTTTCTCCACTGG - Intergenic
1040358358 8:46641404-46641426 TGCCTAAGCCCTTTCTACAGCGG + Intergenic
1040457209 8:47610657-47610679 CAGCTCAGCTCTTTCTCCACAGG + Intronic
1040807071 8:51406746-51406768 CTACCAAGCCCTTTCCACACTGG + Intronic
1043748927 8:83910884-83910906 CTGCTCAGCATTTTCTACAAGGG - Intergenic
1047702540 8:127463976-127463998 CTGCTGAAGCCTTTCTACAGAGG - Intergenic
1052408117 9:28088363-28088385 CTGCTATGCCCTTTAGACTCTGG + Intronic
1053279293 9:36807122-36807144 CTGCTAAGCCCTTTAGCCACTGG + Intergenic
1058454468 9:105126486-105126508 CAGCTAAGCCCTTTTTTCTCTGG - Intergenic
1060069974 9:120537770-120537792 CTTCTAAGCTCTTTATAGACAGG - Intronic
1060801336 9:126547640-126547662 CTGCTAAGCCCTGTGTACCTTGG + Intergenic
1062351496 9:136141908-136141930 CTGCTAAGCCCATCCCACCCCGG + Intergenic
1192289556 X:69779097-69779119 CTGCCAAACTGTTTCTACACTGG - Intronic
1194609008 X:96017570-96017592 CTGCTTACCCCTTTCTTCAGTGG - Intergenic