ID: 1013317849

View in Genome Browser
Species Human (GRCh38)
Location 6:108958910-108958932
Sequence AACCCTGTGCTTCCACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013317849_1013317857 19 Left 1013317849 6:108958910-108958932 CCAGTGAGTGGAAGCACAGGGTT 0: 1
1: 0
2: 2
3: 12
4: 203
Right 1013317857 6:108958952-108958974 CAAAGCAAGAGGGAATAATTTGG 0: 1
1: 0
2: 3
3: 34
4: 328
1013317849_1013317858 22 Left 1013317849 6:108958910-108958932 CCAGTGAGTGGAAGCACAGGGTT 0: 1
1: 0
2: 2
3: 12
4: 203
Right 1013317858 6:108958955-108958977 AGCAAGAGGGAATAATTTGGAGG No data
1013317849_1013317853 8 Left 1013317849 6:108958910-108958932 CCAGTGAGTGGAAGCACAGGGTT 0: 1
1: 0
2: 2
3: 12
4: 203
Right 1013317853 6:108958941-108958963 AGAGTCCTGGCCAAAGCAAGAGG 0: 1
1: 0
2: 2
3: 28
4: 271
1013317849_1013317851 -5 Left 1013317849 6:108958910-108958932 CCAGTGAGTGGAAGCACAGGGTT 0: 1
1: 0
2: 2
3: 12
4: 203
Right 1013317851 6:108958928-108958950 GGGTTCTGGCTCCAGAGTCCTGG 0: 1
1: 0
2: 2
3: 39
4: 359
1013317849_1013317854 9 Left 1013317849 6:108958910-108958932 CCAGTGAGTGGAAGCACAGGGTT 0: 1
1: 0
2: 2
3: 12
4: 203
Right 1013317854 6:108958942-108958964 GAGTCCTGGCCAAAGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013317849 Original CRISPR AACCCTGTGCTTCCACTCAC TGG (reversed) Intronic
901432860 1:9228130-9228152 AACCCAGTTCTTCCACTCATGGG + Intergenic
901467617 1:9432770-9432792 AACACAGTGCTTCCAGCCACAGG - Intergenic
904280121 1:29413173-29413195 AACCCAGCTCTGCCACTCACAGG - Intergenic
904362216 1:29983625-29983647 AACCCTGTGCTTTCCCTCTGTGG - Intergenic
904551241 1:31320796-31320818 GACCCAGTATTTCCACTCACAGG - Intronic
907304103 1:53504333-53504355 AACCCAGCTCTACCACTCACAGG + Intergenic
907952450 1:59196790-59196812 CTCCCTGTGTTTCCACCCACTGG + Intergenic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
908385488 1:63637376-63637398 GAGCCTTTGCTCCCACTCACTGG + Intronic
915584412 1:156836482-156836504 TACCCTGTCCTTCCACACAGAGG - Intronic
917049521 1:170904094-170904116 GACCCAGAGCTTCCACTAACTGG + Intergenic
917966131 1:180179822-180179844 ACCCCTGTGCCTCCTCTCTCAGG - Intronic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
920177895 1:204114546-204114568 AAACCTCTCCTTCCAGTCACTGG - Exonic
921949601 1:220915603-220915625 AACCATGTTTTTCCAGTCACTGG - Intergenic
1063731603 10:8703477-8703499 AAACCTGTGCTTCCAGTTCCCGG + Intergenic
1067272306 10:44803069-44803091 CACCCTGTGCTTCTGCCCACTGG + Intergenic
1067558744 10:47289756-47289778 AAACCTGTGCTGTCACACACTGG - Intergenic
1074553558 10:114467918-114467940 GACACTTTGCTTCCACTTACAGG + Intronic
1074921099 10:118013409-118013431 AACACTGTGCTTTCACAGACAGG + Intronic
1076280849 10:129244537-129244559 GACCCTGTGACTCCACCCACAGG - Intergenic
1076595461 10:131622391-131622413 AATTCTGTTCTCCCACTCACAGG - Intergenic
1076701334 10:132274900-132274922 CACCCTGTTCTTCCACTCCCTGG + Intronic
1076947561 10:133661825-133661847 AACGCTGTTCTTTAACTCACGGG + Intergenic
1081799504 11:45848016-45848038 GCCCCTGTTCTGCCACTCACTGG - Intronic
1085996506 11:81921985-81922007 AAGCCTGTTTTGCCACTCACTGG - Intergenic
1086840597 11:91679121-91679143 AAGCCTATGCTTTCACTCACCGG - Intergenic
1087118375 11:94546325-94546347 AGCACTTTGCTTCCATTCACAGG - Exonic
1088817804 11:113433433-113433455 CTCCCTGGGCTTCCACTAACGGG - Intronic
1089965460 11:122651699-122651721 AACCATGTGCTGCCCCTCTCTGG - Intergenic
1090080463 11:123609063-123609085 TACCCTGTCCCTCCCCTCACAGG + Intronic
1090404664 11:126469467-126469489 ACCCCTCTGCTTCCCCTCCCAGG - Intronic
1091330696 11:134728994-134729016 CACTCTGGGCTTCCACGCACCGG + Intergenic
1091578658 12:1765050-1765072 AACGCAGTAATTCCACTCACAGG - Intronic
1093828691 12:23728059-23728081 AGCCCTGTCCTTTCACTCAGAGG - Intronic
1094313502 12:29112756-29112778 AACCCACTGCTCCCAGTCACAGG - Intergenic
1097303716 12:58046024-58046046 AACCCGGTTCTGTCACTCACTGG - Intergenic
1098322482 12:69260022-69260044 AACCCTTTCCTTTCCCTCACAGG + Exonic
1098591228 12:72215481-72215503 ACCCATGTGCTTCCCATCACTGG - Intronic
1103170869 12:118818634-118818656 CACCCAGTGCTTCCACTCATGGG + Intergenic
1103721671 12:122978686-122978708 AACCCTGGGCTTCCACTCCACGG - Intronic
1103787695 12:123445664-123445686 AACACTCTGCTATCACTCACTGG - Intergenic
1104310484 12:127650381-127650403 CATCCTGAGCTTCCAGTCACTGG - Intergenic
1106650422 13:31684238-31684260 AACACTGTGTTTCAAGTCACTGG - Intergenic
1108408902 13:50128502-50128524 AGTTCTGTGCTTCCTCTCACTGG + Intronic
1113375572 13:109762411-109762433 GACCCTGTTCTTCCACAGACTGG - Intronic
1119953447 14:78769911-78769933 AAACCTGTGTTTCCACACCCTGG - Intronic
1121255522 14:92527735-92527757 CACACTGTGATTCCATTCACAGG - Intronic
1123022181 14:105404972-105404994 AACACTTTAGTTCCACTCACAGG - Intronic
1123145019 14:106120799-106120821 AACCCTGTGCATCCAGACCCAGG - Intergenic
1123196306 14:106619535-106619557 AACCCTGTGCATCCAGACCCAGG - Intergenic
1123204201 14:106695719-106695741 AACCCTGTGCATCCAGACGCAGG - Intergenic
1125102441 15:35930109-35930131 AACCCTGTGCTGCCAAGCTCTGG - Intergenic
1127929517 15:63583050-63583072 GACCCCATGCTTCCACACACGGG + Intronic
1128674247 15:69597007-69597029 ACCCCTGTTCTTTCACTTACTGG + Intergenic
1129454953 15:75671807-75671829 CACTCTGCGCTTCCCCTCACTGG + Intergenic
1133031145 16:3011949-3011971 GAGCCTGTGATTCCACTCATGGG - Intergenic
1133229789 16:4361044-4361066 CTCCCTGCGCTTCCACCCACTGG - Exonic
1134444701 16:14321973-14321995 AACCCAGAGCTTCCAGTCCCTGG + Intergenic
1135030209 16:19032139-19032161 AACACTGTGCATGCTCTCACAGG - Intronic
1136047949 16:27630183-27630205 AACCCTGTTCTGCCACTTTCTGG + Intronic
1136778475 16:32883703-32883725 CACCCTGTGCCTCCACCCCCAGG - Intergenic
1136794669 16:33005427-33005449 AACCCTGTGCCTCCAGACCCGGG + Intergenic
1136871938 16:33815775-33815797 AACCCTGTGCATCCAGACCCGGG + Intergenic
1136875241 16:33848965-33848987 AACCCTGTGCCTCCAGACCCGGG - Intergenic
1136892145 16:33977811-33977833 CACCCTGTGCCTCCACCCCCAGG + Intergenic
1137668881 16:50267670-50267692 AAACATGTCCTTCCACACACAGG - Intronic
1138381810 16:56607895-56607917 CACCCTGCTCTGCCACTCACTGG + Intergenic
1140350947 16:74261462-74261484 ATACCAGTTCTTCCACTCACTGG - Intergenic
1140749541 16:78010751-78010773 AACCCTCTTCCTCCACGCACAGG + Intergenic
1141875400 16:86820653-86820675 CACCCTGTGCTTCCAACCAGGGG - Intergenic
1203080897 16_KI270728v1_random:1145812-1145834 CACCCTGTGCCTCCACCCCCAGG - Intergenic
1203096932 16_KI270728v1_random:1267077-1267099 AACCCTGTGCCTCCAGACCCGGG + Intergenic
1203100234 16_KI270728v1_random:1300293-1300315 AACCCTGTGCATCCAGACCCGGG - Intergenic
1143186286 17:5012453-5012475 GACTCTGTACTTCCACTCAGCGG - Intronic
1147945149 17:44076585-44076607 AACCCTGTCTTTTCACTTACAGG + Intergenic
1148002627 17:44398631-44398653 AAGCCTGTCCTTCCACTGATAGG - Exonic
1148203069 17:45762815-45762837 AAGCCTCTGCTCCCACTCAGGGG + Intergenic
1148610404 17:48961034-48961056 AACCCTGTGTTTACCCTCTCTGG - Intronic
1148735073 17:49860676-49860698 CACCCTCTGCTTCCTCTCAGGGG - Intergenic
1149307647 17:55364510-55364532 AACCTTCTGCATCCACTCATCGG - Intergenic
1154309132 18:13254103-13254125 ATCCCTGGGCTTCCCCTCAGTGG - Intronic
1157549278 18:48570098-48570120 ATCTCTGCTCTTCCACTCACAGG - Intronic
1164578463 19:29419563-29419585 ACCCTTCTGCTTCCACTCAGTGG + Intergenic
1165652379 19:37502561-37502583 AACCCTGTGCTTGCAGAAACAGG - Intergenic
1166201062 19:41238329-41238351 TCCCCTGTGCTTCCTCTCATGGG + Intronic
1166775844 19:45311967-45311989 AACCCTGGGCCTCCACACCCTGG - Intronic
1167257241 19:48438140-48438162 AACCCTGTCCACGCACTCACAGG - Intronic
925262551 2:2541151-2541173 AGCCCTGTACTTTCACCCACTGG - Intergenic
926148611 2:10412000-10412022 AACCCTGTACTGCGACTCAGCGG - Intronic
926158207 2:10469674-10469696 AGCCCTTTCCTTCCCCTCACTGG - Intergenic
927562071 2:24081031-24081053 AACCCTGTACTTTCTGTCACAGG - Exonic
929414499 2:41733616-41733638 AGCTCTGTGCACCCACTCACTGG + Intergenic
929569502 2:43012114-43012136 AACTCTGTGCTTTCACTCCTAGG - Intergenic
931968697 2:67562209-67562231 GACCTTGCGCTTCCACTCATTGG + Intergenic
934511626 2:94948760-94948782 AGCCCTGTGCTTCTCATCACCGG + Intergenic
934699753 2:96430139-96430161 ATCCCTGTGCTCCCACTCCATGG + Intergenic
936696769 2:114959587-114959609 AACCCAGTGATTCCACTCCTAGG - Intronic
937821506 2:126315622-126315644 AACACTGTGTTTCCTCTCTCTGG + Intergenic
938473083 2:131583804-131583826 AACCCTGTGTATCCACCCAAGGG - Intergenic
939772420 2:146337681-146337703 AGCCCTGTTCTTTCACTTACTGG - Intergenic
940691612 2:156926190-156926212 ACCCCTGTGGCTCCTCTCACAGG + Intergenic
945767097 2:213994624-213994646 AACCTTCTGTTTCCATTCACTGG + Intronic
946625770 2:221610914-221610936 AAACCTCTGCTCTCACTCACGGG - Intergenic
947478481 2:230473900-230473922 AAACATGTTCTTCCACTCACAGG + Intronic
948411488 2:237765914-237765936 AAGCCTGTGGTTCCACTCTTTGG + Intronic
1172612803 20:36264359-36264381 CACCCCATCCTTCCACTCACCGG + Intronic
1173924714 20:46772001-46772023 CACCCTGAGCTTCCACCCACTGG - Intergenic
1175023791 20:55880138-55880160 AACACTGTGCCTGCAATCACTGG + Intergenic
1175389116 20:58615288-58615310 AACAATGTGCTGCCAATCACCGG + Intergenic
1175935625 20:62512637-62512659 CACCCTGTGCCCCCAATCACCGG - Intergenic
1176947265 21:14997945-14997967 AACCCTTTCCTTCCAATTACTGG - Intronic
1177659269 21:24062180-24062202 AACCCAGGGCCTCCACTGACTGG + Intergenic
1178430845 21:32517645-32517667 AATCCTGTGTGTCCACTCAGTGG + Intergenic
1178901093 21:36599338-36599360 AACCCTGTGTTTCCTCTAAGAGG - Intergenic
1179036964 21:37766594-37766616 CACCATGTGCTTCCACTGCCCGG - Intronic
1180157717 21:45986214-45986236 CACCCTCAGCCTCCACTCACTGG + Intronic
1181105041 22:20569237-20569259 AACCCTGGGCCTCCAATCCCAGG - Intronic
1181749115 22:24976651-24976673 AAACCTGTTCCTCCACCCACAGG - Intronic
1182767507 22:32768975-32768997 AACCCTGTGCTCCTACTCCATGG + Intronic
1182799436 22:33019362-33019384 AAACCTGTGCTCCCAGTTACAGG - Intronic
1183193928 22:36340332-36340354 TACCCTGTGCTTCCACCAGCTGG - Intronic
1183407040 22:37635300-37635322 GACCCTGGGCCTCCACTCCCTGG + Intronic
1184945723 22:47802449-47802471 CACGCTGTGCTTCCACCCTCAGG - Intergenic
951726095 3:25761683-25761705 AACCCAGTGGTTCCACTCCTAGG + Intronic
952530179 3:34255202-34255224 CAACCTGTGCTTCCGCTCAGAGG + Intergenic
952599948 3:35068336-35068358 AACCCCATTCATCCACTCACTGG + Intergenic
952826541 3:37529716-37529738 AACCCTGTGCCTACACCCAAGGG + Intronic
957447001 3:80326044-80326066 AGCCCTGTGGTTGCTCTCACAGG - Intergenic
960527593 3:118727566-118727588 AACTCTGTGATTCCACTCCTAGG + Intergenic
960922235 3:122758943-122758965 AACTCTGAGATTCCACTCCCAGG - Intronic
960987979 3:123292734-123292756 ATCCCTGTGCTTCTTCTCACAGG + Intronic
966675861 3:182589166-182589188 AACCCAGCCCTTCCACTCCCAGG + Intergenic
971426618 4:26522188-26522210 ATCCCAGTTCTACCACTCACTGG - Intergenic
971728315 4:30342186-30342208 AACACTGTGCTTCCTGTCATAGG + Intergenic
972335114 4:38100963-38100985 ATCCCTGGGCTGTCACTCACCGG + Intronic
973532366 4:51845183-51845205 AACCCAGTGCTTACACACACTGG - Intronic
976088280 4:81429077-81429099 GACCCTGTGCTTGCCCTCAAGGG + Intronic
976339612 4:83932459-83932481 ATCCCTGTGGTTTCTCTCACTGG + Intergenic
976776654 4:88713949-88713971 AGCCTTGTTCTTCCTCTCACAGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
977990514 4:103435554-103435576 AACTCTGTGGTTCCCCTCAGAGG + Intergenic
982060479 4:151599627-151599649 TACTCAGTGCTTCCAGTCACTGG + Intronic
982660294 4:158198804-158198826 CACCCTGTGAATCCACTGACTGG + Intergenic
985451017 4:190062622-190062644 AACGCTGTTCTTTAACTCACGGG + Intergenic
985852426 5:2398351-2398373 ACACCTGTCCTTCCCCTCACAGG - Intergenic
986652775 5:9980696-9980718 AACTTTGTGCTTCTACTCACAGG - Intergenic
986843021 5:11720064-11720086 ATCTCTGTGCTGCCACCCACTGG + Intronic
987175929 5:15309420-15309442 AGCCCTTTCCTCCCACTCACGGG - Intergenic
987327639 5:16826920-16826942 GACCCTGTGCTTTCAATGACTGG + Intronic
988804947 5:34731794-34731816 AACACTGTGCTTGCACTGGCTGG + Intronic
990204822 5:53417258-53417280 GTCCCTGTGCTTCCACTTGCAGG - Intergenic
990599421 5:57342527-57342549 AACTGTGTGCTTCAACACACAGG - Intergenic
990722841 5:58717424-58717446 AAGCCTGTCCTGCCACCCACAGG + Intronic
994283855 5:97939396-97939418 TACCCTGTAATTCCACTCAAAGG - Intergenic
996681526 5:126232532-126232554 AACCCAGTGGTTTTACTCACTGG - Intergenic
997234467 5:132264828-132264850 TACCCTGTGCTCTCACTCCCAGG + Intronic
999732490 5:154485007-154485029 AACCCTTTCCTTCTGCTCACAGG + Intergenic
1000244442 5:159437674-159437696 AATCCAGCTCTTCCACTCACTGG - Intergenic
1001265106 5:170268478-170268500 AACCTTGTGTTTCCACAGACCGG - Exonic
1001445218 5:171777601-171777623 AACACTGAGCTTCTACTCAGTGG + Intergenic
1004115616 6:12764575-12764597 AACCGTGTTCTCCCACTCAGGGG - Intronic
1008402857 6:51084159-51084181 CACTCTGTGCTTCCTCCCACAGG - Intergenic
1008590083 6:52985583-52985605 AACTCTGGGCTTCCATTCTCAGG - Exonic
1008888177 6:56454250-56454272 AACACTATGCTTGCACACACAGG - Intergenic
1011556236 6:88573715-88573737 AGCCCTGAGCTTCCACACAGGGG + Intergenic
1012104238 6:95133757-95133779 AACGTTTTGCTTCCACCCACAGG + Intergenic
1013317849 6:108958910-108958932 AACCCTGTGCTTCCACTCACTGG - Intronic
1015974575 6:138776208-138776230 AACCCTGTGCTTTTACTCACTGG - Exonic
1017590027 6:155968691-155968713 AACCCTGTGCTTCCCTCCAAAGG + Intergenic
1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG + Intronic
1019014696 6:168871353-168871375 AAGCCTGGGCTCCAACTCACTGG + Intergenic
1021608047 7:22429154-22429176 AACCCTGGCCCTCCACTCATAGG + Intronic
1022617948 7:31951771-31951793 AACCCAGTTCTCCCACACACCGG - Intronic
1023784029 7:43687817-43687839 AAACCTGTACTTCCATTAACAGG + Intronic
1023843704 7:44109790-44109812 CAGCCTGTGCTTCCCCTCCCTGG - Intronic
1025264273 7:57442317-57442339 AGCCTTGTGCCTTCACTCACAGG + Intergenic
1026576422 7:71575337-71575359 AACCCTATGCTTTCATTCAATGG + Intronic
1033178832 7:139153853-139153875 GACCCTGTGATTCCACTCCTAGG - Intronic
1033651409 7:143346420-143346442 CACCCTCTGCTCCCACTCCCTGG - Intronic
1033670346 7:143486692-143486714 GACCCAGTGCTTCCACTCCTGGG + Intergenic
1034671478 7:152862178-152862200 CACCCTGTACTTCCTCTCACGGG - Intergenic
1034843385 7:154420418-154420440 TACCGTGTGATTCCACTCATAGG + Intronic
1036656738 8:10681808-10681830 TGCCCTGTGCCTCCACTGACCGG - Intronic
1037310492 8:17550491-17550513 GACCCTCTGCTACCACACACGGG - Intronic
1037537211 8:19835845-19835867 AACCCTGAGCAGCCACACACAGG + Intronic
1037676457 8:21055103-21055125 AACCCTGTTCTTCCTTACACAGG - Intergenic
1039391338 8:37183243-37183265 GTCCCTGATCTTCCACTCACTGG - Intergenic
1039840991 8:41292992-41293014 CAGCCGCTGCTTCCACTCACAGG - Intronic
1039920692 8:41892254-41892276 TCCCCTGTGATTCCAATCACTGG + Intronic
1041628808 8:60061729-60061751 TACCCAGTGCTTGGACTCACTGG - Intergenic
1046007868 8:108507811-108507833 TTCACTGTGCTTCCACTCCCAGG + Intergenic
1048996332 8:139795862-139795884 GACCCTGTGCATTCACGCACTGG - Intronic
1051493261 9:17690604-17690626 ACCACTGGGCTTCCACTCACAGG - Intronic
1052525739 9:29616570-29616592 AAGCCTTTACTTCCTCTCACTGG - Intergenic
1053023214 9:34709757-34709779 ACCCCTTTGTGTCCACTCACAGG + Exonic
1055978589 9:81977758-81977780 ATGGCTGTGCTTCCACTCTCAGG - Intergenic
1056215288 9:84400632-84400654 AACCCTGTGCTGCAAGCCACAGG - Intergenic
1056998616 9:91487335-91487357 AGCCCTTTGCTTCTCCTCACTGG - Intergenic
1057445214 9:95109400-95109422 AACCCTGTGGTTCCACTTCTAGG - Intronic
1058814786 9:108673015-108673037 AAACCTGTTCTTCCACTAAGAGG + Intergenic
1059039917 9:110801177-110801199 TAGCCTGTGTTTCCAATCACTGG - Intronic
1060213128 9:121722588-121722610 AACCCAGGGCTCCCACTGACTGG + Intronic
1061000582 9:127899902-127899924 CACGCTGTGCTTGCACTCAGTGG + Intronic
1061368490 9:130185055-130185077 AGCCCTCTGCTTCCTCCCACTGG + Intronic
1062103862 9:134742088-134742110 CACCCTGTGCCTCCACTGGCTGG + Intronic
1062358388 9:136175889-136175911 AACCCTGAGCTTCCTCAGACAGG - Intergenic
1203784681 EBV:120910-120932 TACCCCTGGCTTCCACTCACGGG - Intergenic
1185633402 X:1534514-1534536 AACCCTGCTCTTCCTCTCTCGGG - Intronic
1191239010 X:58164704-58164726 AAACCTGTGTTTTGACTCACTGG + Intergenic
1193052970 X:77121071-77121093 GTCCCAGTTCTTCCACTCACTGG + Intergenic
1194346661 X:92773638-92773660 AACCCTATGCATGCACACACTGG - Intergenic
1200654995 Y:5890282-5890304 AACCCTATGCATGCACACACTGG - Intergenic
1202266764 Y:23027993-23028015 CATCCTGTGCTTCCACTGATTGG - Intergenic
1202419757 Y:24661738-24661760 CATCCTGTGCTTCCACTGATTGG - Intergenic
1202451029 Y:25008346-25008368 CATCCTGTGCTTCCACTGATTGG + Intergenic