ID: 1013324442

View in Genome Browser
Species Human (GRCh38)
Location 6:109030868-109030890
Sequence CAGAGCTACAAGTCAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013324440_1013324442 9 Left 1013324440 6:109030836-109030858 CCATGAAGAAATGTCATACAACT 0: 1
1: 0
2: 1
3: 20
4: 281
Right 1013324442 6:109030868-109030890 CAGAGCTACAAGTCAAATGCAGG 0: 1
1: 0
2: 4
3: 28
4: 223
1013324438_1013324442 19 Left 1013324438 6:109030826-109030848 CCTATATTACCCATGAAGAAATG 0: 1
1: 2
2: 5
3: 94
4: 743
Right 1013324442 6:109030868-109030890 CAGAGCTACAAGTCAAATGCAGG 0: 1
1: 0
2: 4
3: 28
4: 223
1013324439_1013324442 10 Left 1013324439 6:109030835-109030857 CCCATGAAGAAATGTCATACAAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1013324442 6:109030868-109030890 CAGAGCTACAAGTCAAATGCAGG 0: 1
1: 0
2: 4
3: 28
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013324442 Original CRISPR CAGAGCTACAAGTCAAATGC AGG Intronic
902132469 1:14274671-14274693 CAGAGCTAGAAGTCAAACCCAGG - Intergenic
902791843 1:18774429-18774451 CAGAGCTAGAATTCAAACCCTGG + Intergenic
903005907 1:20298674-20298696 CAGTGCTACAAGTCAAAGCCTGG + Intronic
903452756 1:23465802-23465824 CAGAGTTACAATTTAAATCCAGG + Intronic
904352030 1:29914733-29914755 CTGAGCTGGAATTCAAATGCAGG + Intergenic
905253983 1:36668303-36668325 CAGAGCATTAAATCAAATGCAGG + Intergenic
907610412 1:55864266-55864288 CATAGCTAGAAGTCAATTCCTGG + Intergenic
908087566 1:60652705-60652727 CAGAGTTAGCATTCAAATGCAGG - Intergenic
908397989 1:63743813-63743835 CAGAGCCAGAATTCAAATCCAGG + Intergenic
908427484 1:64021605-64021627 CAGAGCCAGAATTCAAATCCAGG + Intronic
908450166 1:64246856-64246878 CAAAGCTGAAATTCAAATGCAGG + Intronic
908454242 1:64286380-64286402 CACAGCTAGAAGTCAAACCCAGG - Intergenic
908468702 1:64420786-64420808 CAGAGCTGCAACTGAAATCCAGG + Intergenic
908527543 1:65002408-65002430 CAGAGCTGCGAATCAAATCCAGG - Intergenic
908706410 1:66961288-66961310 TAGAGCTACAACTAAAATTCAGG - Intronic
908753327 1:67445267-67445289 CATTGCTACAAGACAGATGCTGG + Intergenic
913176163 1:116274933-116274955 CAGAGGTAGGAGTCAAATCCAGG + Intergenic
915122979 1:153643439-153643461 CACAGCTTCAAGTCATAGGCAGG + Intronic
916078420 1:161216955-161216977 CAGAGCTGGAACTCAAATGCAGG - Intronic
916894952 1:169152410-169152432 CAGAGCTAGAATTCAAACCCAGG + Intronic
917162223 1:172070646-172070668 CAGAGCTGAAATTCAAATTCAGG - Intronic
917282516 1:173392147-173392169 CAGAGCTACTAGTAGAGTGCAGG - Intergenic
917402415 1:174665224-174665246 CAGAGCTAGAATTCAAACTCTGG - Intronic
919576162 1:199312193-199312215 CAGAGCCAGAACTCAAATCCAGG + Intergenic
920651526 1:207840870-207840892 CAGAACTAAAATTCAAATCCAGG + Intergenic
921907663 1:220512406-220512428 CAGAGCATTAAATCAAATGCAGG - Intergenic
922219804 1:223549969-223549991 CAAAGCTAGGAGTTAAATGCAGG + Intronic
924090295 1:240494044-240494066 CAGAAGTACAAAGCAAATGCTGG + Intronic
1067269307 10:44775617-44775639 CAGAGCGGCAGGTCGAATGCAGG + Intergenic
1068957572 10:62832747-62832769 CAGAGCAACAAGTTAACTGGTGG - Intronic
1069119139 10:64546871-64546893 GAGAACTGGAAGTCAAATGCAGG + Intergenic
1069547011 10:69335796-69335818 CAGAGCCAGAAGTCAAATGCAGG + Intronic
1072678121 10:97483993-97484015 CTGGGCTACAAGACAAATTCAGG + Intronic
1077814668 11:5675294-5675316 CAGAGCATTAAATCAAATGCAGG + Intronic
1077897950 11:6467957-6467979 CTGAGCTACAAGCAAAAAGCTGG + Intronic
1078134049 11:8637748-8637770 CAGAGCTTCAAGTCCAGGGCTGG + Intronic
1078493787 11:11795875-11795897 CAGAGCTAGGATTCAAATTCAGG + Intergenic
1080448556 11:32359545-32359567 CAGAGCTGAAAGTCAAAAGGTGG + Intergenic
1081103182 11:39031058-39031080 CATAGCTTCAAGACAAAAGCAGG + Intergenic
1081380043 11:42403794-42403816 CAGAAGACCAAGTCAAATGCAGG - Intergenic
1081944894 11:46982989-46983011 CAGAGCTAGAAATCATATCCAGG + Intronic
1083237927 11:61363767-61363789 CAGAGCTAGTATTCAGATGCAGG - Intronic
1083812629 11:65114260-65114282 CAGAGCTCAGTGTCAAATGCAGG + Intronic
1085775595 11:79363449-79363471 CACAGCCACAAGTCAAACTCAGG - Intronic
1086502799 11:87470844-87470866 TAGAGCTAGAATTTAAATGCAGG + Intergenic
1086877354 11:92112481-92112503 CAGAGGCACAGGTGAAATGCTGG + Intergenic
1087158982 11:94930807-94930829 GAGAGCTGGAAGTCAAATCCAGG + Intergenic
1087413289 11:97820292-97820314 CAGAAATACAAGGCAAAGGCAGG - Intergenic
1087958270 11:104316983-104317005 CAGAGCGGGAATTCAAATGCAGG - Intergenic
1088023400 11:105148120-105148142 CAGAGCCAGAATTCAAATCCAGG + Intergenic
1088394358 11:109350238-109350260 CTCAACTACAATTCAAATGCCGG - Intergenic
1088702006 11:112421876-112421898 CAGCGCTAAGATTCAAATGCAGG + Intergenic
1089514218 11:119021521-119021543 CAGAGCTAGAACTCAAAGCCTGG + Intronic
1091533702 12:1385765-1385787 AAGAGCTGCAAGTCAGGTGCTGG - Intronic
1092959581 12:13583440-13583462 CAGAGCAAGGATTCAAATGCAGG + Intronic
1093088367 12:14892160-14892182 CAGAGCTAGAAGTCAAATCCAGG - Intronic
1093825346 12:23678779-23678801 AAGAGCTAGAATTCAAATCCAGG + Intronic
1094697687 12:32837290-32837312 CAGAGTTGAAACTCAAATGCCGG - Intronic
1095597434 12:43975547-43975569 CAGAGTCAGAATTCAAATGCAGG + Intronic
1098227755 12:68342280-68342302 CAGAGCTAAAAGTCAAACCCAGG + Intergenic
1098444306 12:70550613-70550635 CAGAGCTGGAACTCAAATGCAGG + Intronic
1098661571 12:73101038-73101060 CAGAGCTACAAGTCACCTGGGGG - Intergenic
1098783097 12:74713343-74713365 CAAAGTTGCAATTCAAATGCAGG + Intergenic
1101002882 12:100374181-100374203 CAGAGCTGGAAATCAAATCCAGG + Intronic
1102885418 12:116518115-116518137 CAGATCTGCAAGTCACAGGCAGG - Intergenic
1103024855 12:117565130-117565152 CAGAGCTGGAATCCAAATGCTGG + Intronic
1108358082 13:49645049-49645071 TAGAGGTACAAGTTAAATGACGG - Intergenic
1108556280 13:51595930-51595952 CAGAGCAAAGAGTCAAATCCAGG - Intronic
1110321850 13:74169425-74169447 CAGAGCTAGAATTAAAATCCAGG + Intergenic
1111122182 13:83867415-83867437 CAGAGCCAAAATTCAAATCCAGG - Intergenic
1111548213 13:89772350-89772372 AAGAGCTAGAAGTCAAATACTGG - Intergenic
1113046369 13:106159638-106159660 CAGAACTAAAAGGCAAATGAAGG - Intergenic
1113591421 13:111503886-111503908 CAGAGCTGGAAGTCAAAAACAGG - Intergenic
1114878184 14:26750164-26750186 AAGAGCTACAAAACAGATGCAGG - Intergenic
1114883063 14:26810908-26810930 CAGAAGTACAAATCAAATGGTGG - Intergenic
1115430519 14:33312693-33312715 CAGAGCTTCACGTCAAAGGCTGG - Intronic
1117150994 14:52887713-52887735 CAGAGCTAGAATTCACATCCAGG - Intronic
1117869482 14:60185454-60185476 CAGAGCTGCAATTTGAATGCAGG - Intergenic
1118434334 14:65755755-65755777 CATAGCTCCAAGTCACAAGCAGG - Intergenic
1120350091 14:83343846-83343868 CAGAGGTGCAAGTCAAAGGCAGG + Intergenic
1122348456 14:101074451-101074473 CGGAGCTACAGGTCACAAGCTGG + Intergenic
1123103386 14:105821184-105821206 CAGAGCTACAATCTAAAAGCAGG + Intergenic
1125887870 15:43242204-43242226 CAGAGCTACCACTAAAATCCTGG + Intronic
1126088399 15:45030103-45030125 CCAAGCTACAAGTTAAATCCTGG - Intronic
1128569073 15:68720190-68720212 CAGAGCCAGGATTCAAATGCAGG - Intronic
1128741048 15:70083782-70083804 CAGCACTACAAATGAAATGCTGG + Intronic
1130752306 15:86725109-86725131 CAGAGCTAAAAATTAAATGTGGG + Intronic
1130986865 15:88849991-88850013 CAGAGCCATAACTCAAATTCAGG - Intronic
1133477551 16:6138114-6138136 TAGAACTAGAATTCAAATGCAGG - Intronic
1134022713 16:10932396-10932418 CTGAGCTCCATGTGAAATGCAGG - Intronic
1134830601 16:17319769-17319791 CAGAGCTGGAATTCAAATTCAGG - Intronic
1135149613 16:19994065-19994087 CGGAGCTGCAATTCAAATTCAGG - Intergenic
1135815642 16:25630233-25630255 CTGAGCTGAGAGTCAAATGCTGG + Intergenic
1138249197 16:55489374-55489396 CAGAGCTGCAATTCAAACCCAGG - Intronic
1139463259 16:67139754-67139776 CAGAGCTTCATGTCACATGTGGG + Intronic
1140731072 16:77856871-77856893 GAAAGCTGGAAGTCAAATGCAGG - Intronic
1140855575 16:78975066-78975088 CAGAGTAACAAGGCAAAAGCAGG - Intronic
1141218475 16:82046880-82046902 CAGTGCTGGAATTCAAATGCAGG + Intronic
1142980836 17:3670358-3670380 CAGAGCCAGGATTCAAATGCAGG + Exonic
1145215976 17:21052791-21052813 CAGACCTCAAAGTGAAATGCGGG + Intergenic
1145835887 17:27953859-27953881 GAGAGCAAGAATTCAAATGCTGG + Intergenic
1146487250 17:33253196-33253218 CAGAGCTGGAGTTCAAATGCAGG + Intronic
1148984456 17:51609585-51609607 CAGACCTTCAGGTCAAGTGCAGG + Intergenic
1150605137 17:66684364-66684386 CAGAGCCAGAATTCAAATGCAGG + Intronic
1151077053 17:71286211-71286233 CAGAGCTAAGAGTCAAACTCAGG + Intergenic
1153524964 18:5986143-5986165 CAGGGGAACAAGTCAAAGGCAGG - Intronic
1155344729 18:24847128-24847150 CAGACCTCCAAGTGAAATGGAGG - Intergenic
1155582058 18:27320377-27320399 CAGATTTTCAAGTCAAATGTGGG - Intergenic
1157483360 18:48070065-48070087 CAGAGCCAGAAGTCAAATCCAGG + Intronic
1158720283 18:59918526-59918548 CAGAGATAAACGGCAAATGCGGG - Intergenic
1162466317 19:10843282-10843304 CAAAGCTACAAGTCAAATCCAGG - Intronic
1164155450 19:22593833-22593855 CAGAGCAACACTTCAAATCCTGG - Intergenic
1164846668 19:31438477-31438499 CAGAGACAGAAGTCAAAGGCTGG + Intergenic
1165792413 19:38500185-38500207 CAGAGCTCCCAGTCCAATGGGGG + Intronic
1166110256 19:40617953-40617975 CAGAGTTAAAAGTAAATTGCAGG + Intronic
1166136473 19:40780192-40780214 CATAGGTACAAGTCCAGTGCTGG + Intronic
927814561 2:26203289-26203311 CTCAGCTAAAAGTCACATGCAGG + Intronic
928056190 2:28057637-28057659 CAGACCTACAACTCAAATAAAGG + Intronic
928200131 2:29242605-29242627 CAGGGCTCCAAGTCATCTGCTGG + Intronic
929421379 2:41793221-41793243 AAGAGCTACAAGAAAAATGTTGG + Intergenic
929723110 2:44391914-44391936 CAGAGCCAGAAGTCAAATGCAGG - Intronic
930991092 2:57655462-57655484 CCAAGCTACAAGTCAAATCCTGG - Intergenic
933510018 2:83228964-83228986 CATAGCAGCAAGTAAAATGCTGG + Intergenic
933616032 2:84483329-84483351 GAGAGCTACTGGTCAAAAGCAGG - Intergenic
935280536 2:101513667-101513689 CAAACCTACTACTCAAATGCAGG - Intergenic
938233228 2:129679787-129679809 CAGAGCCAGAAGTCAAAACCAGG + Intergenic
941403911 2:165065067-165065089 CAGAGTTAACAGTCAAATTCAGG - Intergenic
941805513 2:169708168-169708190 CAGAGCTAGAATTCAAATTCAGG - Intronic
943676032 2:190717270-190717292 CAGAGCAACAAGAAAAATGCCGG - Intergenic
944847422 2:203682627-203682649 CAGAGCTAGGATTCAAATCCAGG + Intergenic
945593048 2:211757858-211757880 CACAGCTACAAATAAAAGGCTGG + Intronic
946311782 2:218886043-218886065 TAGATCTAGGAGTCAAATGCAGG + Intronic
1169111838 20:3039143-3039165 CAGATCTAGAAGTCAGATGGTGG + Intergenic
1169375522 20:5063890-5063912 GAGAGCTACATGTCAAAATCTGG + Intergenic
1172930135 20:38580671-38580693 AACTGCTACAAGTGAAATGCAGG - Intergenic
1173089346 20:39955441-39955463 CAGAGCCACAACTCAAAAGAGGG - Intergenic
1173899362 20:46575807-46575829 TAAAGCTCCAAGTCAAATGCTGG - Intronic
1179513600 21:41891621-41891643 CAGAGCTTCAAGGCAGGTGCAGG - Intronic
1179610094 21:42544715-42544737 CAGAGCTGAAAGCCACATGCTGG - Intronic
1180943145 22:19673293-19673315 CAGAGCTACAAGAGAAATGATGG - Intergenic
1181994220 22:26862254-26862276 CAGAGGTACCTTTCAAATGCTGG + Intergenic
1182163171 22:28144241-28144263 CAGAGCTACAATTCAAACCAGGG + Intronic
1182265313 22:29110189-29110211 CAGAGCTCCCAGTTGAATGCAGG - Intronic
1182893843 22:33842860-33842882 GAGAGCAACAGGTAAAATGCTGG - Intronic
1183259408 22:36784790-36784812 CTGAGCTAGGAGTCAAATTCAGG + Intergenic
1183366303 22:37408975-37408997 CAGAGCTGCAATTCGAACGCTGG + Intronic
1184442866 22:44529109-44529131 CAGAGCTACAACTCCAATTTAGG - Intergenic
949577594 3:5353662-5353684 CAGAGCTGAAATTCAAATGTAGG - Intergenic
949787452 3:7757627-7757649 TGCAGCCACAAGTCAAATGCTGG + Intergenic
949937255 3:9125627-9125649 CAGGGCAACAATTCAAAAGCTGG + Intronic
951149313 3:19268730-19268752 CAGACCTACAAATCAAATCTGGG + Intronic
951378629 3:21955341-21955363 CAAAGCTACATGGAAAATGCAGG + Intronic
951636638 3:24786173-24786195 CAGAGCTCCAAGCCATCTGCAGG - Intergenic
952946319 3:38479851-38479873 CACAGCTCCAGGTCAAGTGCAGG - Intronic
957299467 3:78372733-78372755 CAGAGCTAAGATTCAAATCCAGG - Intergenic
959441539 3:106382529-106382551 CAGAGCAAGGATTCAAATGCAGG - Intergenic
960596212 3:119410385-119410407 CAGAGCTGCCTCTCAAATGCAGG - Intronic
963381809 3:144539938-144539960 CAGAGCAACAGGTCAAAAGAGGG + Intergenic
964848918 3:161072943-161072965 CAGAGCTGGATGACAAATGCTGG - Exonic
965203298 3:165688825-165688847 CAGACATAAAAGTCAATTGCTGG + Intergenic
965657021 3:170998211-170998233 CAGAGCTACAATGAAATTGCAGG + Exonic
965669730 3:171134941-171134963 CTGAGTTACAAAACAAATGCTGG + Intronic
965968568 3:174526322-174526344 CAGAGCTAGAATTCGAAAGCTGG - Intronic
969977148 4:11115321-11115343 CAGAGAAGCAAGTTAAATGCAGG - Intergenic
970440653 4:16078451-16078473 CAGAGCTACAGGGCAAGTGCTGG + Intronic
970869598 4:20799785-20799807 CACAGCTACAATTCAGATCCTGG - Intronic
970967630 4:21947352-21947374 CACAGTTACAAGTCAAATGTGGG + Intronic
972174411 4:36385948-36385970 CAGAGCTACAAAACAAACACAGG + Intergenic
972566470 4:40273683-40273705 CAGAGCCAGAATTCAAATCCAGG + Intergenic
974102336 4:57430822-57430844 CAGAGCTAGAATTCATATCCAGG + Intergenic
974181736 4:58392785-58392807 AACAGCTACAAATGAAATGCTGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
977151215 4:93514549-93514571 GAGAGCTAGAATTCAAATGTGGG - Intronic
980081577 4:128350320-128350342 CCAAGTTACAAGTTAAATGCTGG + Intergenic
980556431 4:134412084-134412106 CAAAGCTACAATTCAAACTCTGG - Intergenic
982362573 4:154536095-154536117 CAGAGGTGCAGGTGAAATGCTGG - Exonic
984740200 4:183154207-183154229 CAGAGCCAGGATTCAAATGCAGG - Intronic
987827250 5:23048342-23048364 CAGCGTTATAAGTCAAAAGCTGG - Intergenic
988072768 5:26315502-26315524 CAGAACTGCCAGTCAAGTGCTGG - Intergenic
988289083 5:29261512-29261534 CTGAGCTAAAACTCAAATGAAGG - Intergenic
988578425 5:32447900-32447922 CACACCTACAAGTCAAAAGTAGG + Intergenic
989487855 5:42012767-42012789 CAGAGCCAGAAGTTATATGCAGG - Intergenic
989726267 5:44590033-44590055 CACAGCTCAAAGTAAAATGCCGG - Intergenic
990285366 5:54296434-54296456 CAGAGCTAGAATGCAAATGCAGG + Intronic
991186980 5:63820475-63820497 AAAAGCCAAAAGTCAAATGCTGG + Intergenic
991699922 5:69307995-69308017 CAAAGCCACAAGTCATACGCAGG - Exonic
991723988 5:69517767-69517789 CAGGGCTTCAAGTCAAGGGCAGG - Intronic
992880879 5:81108457-81108479 CAGAGGTACTAGTAAAATGTGGG + Intronic
993480608 5:88419962-88419984 CAGAGCTGAAAGGCAAATGCTGG - Intergenic
993938005 5:94026708-94026730 CCAAGCTACAGGTCAAATCCAGG - Intronic
994496369 5:100518032-100518054 CAGAGGCACAAGTGCAATGCTGG + Intergenic
996406981 5:123115111-123115133 CAGATCTGCAAGTCAAATGTGGG + Intronic
997771690 5:136560973-136560995 CAGAGCTGCAACTCAAACTCAGG + Intergenic
998985214 5:147749428-147749450 CAGAGCTAGAAGTCAAACCCTGG + Intronic
999905968 5:156141621-156141643 CAGAGATACAAGATAAATGGGGG + Intronic
1000058963 5:157635960-157635982 CAGAGCCAATAGTCAAATTCAGG - Intronic
1001246512 5:170109000-170109022 CAGAGCTAAGAGTCAAATCCAGG + Exonic
1001298006 5:170512472-170512494 CAGACCTAGAATTCAAATCCTGG + Intronic
1003536500 6:6980172-6980194 CAGAGCAAGAAATCAAATCCAGG + Intergenic
1007027302 6:38589399-38589421 CAGCACTTCAAATCAAATGCAGG + Intronic
1008645820 6:53513545-53513567 CAGAGCCAAAAGCCAACTGCAGG + Intronic
1010732666 6:79407128-79407150 CAAAGCTAGGATTCAAATGCAGG + Intergenic
1013324442 6:109030868-109030890 CAGAGCTACAAGTCAAATGCAGG + Intronic
1015337791 6:132061300-132061322 TGGAGCTACAAGTGAGATGCTGG - Intergenic
1017014308 6:150087901-150087923 CTGGGCTACAAGTGAAATGATGG - Intergenic
1017118529 6:151002069-151002091 TAGAGCTACTTGTTAAATGCTGG + Intronic
1023939574 7:44761076-44761098 CAGAGCTATAGGGCAATTGCAGG + Intronic
1025614464 7:63106176-63106198 CAGAGCCACACATCAAATCCAGG - Intergenic
1026128532 7:67600911-67600933 CAGAGCTAGAATTGAAATCCAGG + Intergenic
1027631978 7:80618150-80618172 CTGAGCTAAGAGTTAAATGCTGG - Intronic
1028530836 7:91837017-91837039 TAGAGCTACAAGACAAACCCAGG + Intronic
1028603224 7:92625900-92625922 CATAGCTGCAGGTCAAATACAGG - Intronic
1030005505 7:105114563-105114585 CAGAGGTAGAAGACAAAGGCTGG - Intronic
1030643273 7:112030072-112030094 CACATCTCCAATTCAAATGCTGG + Intronic
1031171464 7:118297345-118297367 CAGAGATATAAGTTATATGCAGG - Intergenic
1031864111 7:127018655-127018677 CAGACCAAAAAGTCATATGCAGG + Intronic
1032713192 7:134480833-134480855 CAGAGTTGGAATTCAAATGCAGG + Intergenic
1032925080 7:136594932-136594954 CAGAGCTAAAAGCCAAAGGCAGG - Intergenic
1036635824 8:10548898-10548920 CAGAGATCAAAGTCAAAAGCAGG + Intronic
1037206339 8:16324661-16324683 TAGAATTTCAAGTCAAATGCTGG + Intronic
1037478903 8:19286238-19286260 CAGAGACACAAGTGGAATGCTGG - Intergenic
1038136762 8:24794343-24794365 CCTAGCTACAAGTAAAAAGCGGG - Intergenic
1038794740 8:30699861-30699883 CAGAGGCCAAAGTCAAATGCAGG - Intronic
1044634011 8:94304327-94304349 GAGACCTGCAAGCCAAATGCAGG + Intergenic
1045679671 8:104645270-104645292 CAGATCTTCAAGTCTAATTCAGG + Intronic
1048487088 8:134858383-134858405 AAGAGCTAACAGTCAAATGAGGG - Intergenic
1049730345 8:144174257-144174279 CCAAGCTACAAGTAAAATCCTGG - Intronic
1050116700 9:2270965-2270987 CAGAGCTAGAATTCAAATCCAGG + Intergenic
1050243506 9:3662113-3662135 CACAGCTAGCATTCAAATGCAGG - Intergenic
1050338829 9:4615635-4615657 CAGAAGTACAATCCAAATGCAGG - Intronic
1051982454 9:23038753-23038775 CAGAGTTACAATTCAAATTAAGG + Intergenic
1052495672 9:29220529-29220551 CAGAGCCAGAATTCAAATCCAGG - Intergenic
1054823078 9:69543308-69543330 CAGAGCCACAAGTGCAGTGCAGG - Intronic
1054869205 9:70033778-70033800 CAGAGCTACAAGTTGAACCCAGG + Intergenic
1059019019 9:110553208-110553230 CAGAGCTTCACGTCAACTACAGG + Intronic
1059632919 9:116143762-116143784 TAGAGCTACAATTCAAACTCAGG - Intergenic
1059858180 9:118425301-118425323 CAGAGCTAAAAGTAAGTTGCAGG - Intergenic
1061177890 9:129008475-129008497 CAGAGCCACAGGTCAGAAGCAGG + Exonic
1062184819 9:135212481-135212503 CAGAGCTCTGAGTCAAAAGCAGG - Intergenic
1186764577 X:12757890-12757912 CAGAGCCAAAATTCAAATTCTGG + Intergenic
1187073589 X:15912355-15912377 TAGAGCTACAAGTCATCTGGTGG + Intergenic
1187412728 X:19064768-19064790 CAGAGTTACAATTCAAATTCAGG - Intronic
1187637759 X:21250949-21250971 CAGATCTACAGGTCAGATGTTGG + Intergenic
1188572005 X:31598684-31598706 AGGAGCTACAAGTCATATTCAGG + Intronic
1189370189 X:40421789-40421811 CAGAGCTGGAATTCAAATTCAGG + Intergenic
1190393528 X:49956305-49956327 CAGAGCTAGAATTCAAATCCAGG - Intronic
1190576431 X:51844135-51844157 CAGAGGGAGAAGTCACATGCTGG - Intronic
1193136917 X:77982742-77982764 AAGAGCTAGGATTCAAATGCAGG - Intronic
1193878175 X:86888642-86888664 CAGAGCTGAAAATCAAGTGCCGG + Intergenic
1195618991 X:106934550-106934572 AGGAGCTACTACTCAAATGCTGG - Intronic
1195956561 X:110337091-110337113 CAGAGCTGGAATTCAAATCCAGG - Intronic
1196335899 X:114533836-114533858 TAAAGCTAAAATTCAAATGCAGG - Intergenic
1197396335 X:125932075-125932097 CCAAGCTACAAGTCAAATCCAGG - Intergenic
1199324727 X:146484478-146484500 CTGAGCTAAAAGAAAAATGCTGG - Intergenic
1200846825 Y:7838881-7838903 CAGAGGTAAAAGTCAAATTTTGG - Intergenic
1202043625 Y:20714115-20714137 TAGAGAGCCAAGTCAAATGCAGG + Intergenic