ID: 1013327466

View in Genome Browser
Species Human (GRCh38)
Location 6:109061918-109061940
Sequence TTCTGTCCTCCACTAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013327466_1013327469 24 Left 1013327466 6:109061918-109061940 CCTCACTTTAGTGGAGGACAGAA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1013327469 6:109061965-109061987 TGATAAAAGATGGTGCTCTGAGG 0: 1
1: 0
2: 0
3: 16
4: 189
1013327466_1013327468 14 Left 1013327466 6:109061918-109061940 CCTCACTTTAGTGGAGGACAGAA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1013327468 6:109061955-109061977 TATCTAAACGTGATAAAAGATGG 0: 1
1: 0
2: 2
3: 2
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013327466 Original CRISPR TTCTGTCCTCCACTAAAGTG AGG (reversed) Intronic
903451050 1:23453851-23453873 TTCTCTCCCCCACTAGACTGTGG + Intronic
903479764 1:23644738-23644760 TTCTGGCCTCCAGAACAGTGAGG + Intergenic
904532850 1:31180717-31180739 CTCTCTCCTCCAGGAAAGTGGGG - Exonic
904971334 1:34421571-34421593 TTCTGGCCTCCAGAACAGTGAGG + Intergenic
905716571 1:40156701-40156723 TTGTGTAGTCCTCTAAAGTGTGG + Intergenic
906979200 1:50610136-50610158 TACTGTACTCCAATACAGTGGGG + Intronic
907047791 1:51310360-51310382 TTCTGTCCTCCAGTCGGGTGTGG + Intronic
908469262 1:64426861-64426883 TTCTGTCTTCCAACAAAGTTTGG - Intergenic
909001738 1:70225728-70225750 TTCTGTCCTCCAACTAAGAGCGG - Intronic
909529541 1:76666893-76666915 TTCTCTGCTCCATTAATGTGGGG - Intergenic
911139763 1:94486549-94486571 TTGTCTGCTCCACTAAAATGTGG - Intronic
911344692 1:96682253-96682275 TTTTGTCCTCTACTAAAATAGGG - Intergenic
911520628 1:98925935-98925957 TTGTTTCCTTCACTAGAGTGAGG + Intronic
911783999 1:101921602-101921624 TTCTATCCTCAACTACAGAGGGG + Intronic
917445469 1:175102747-175102769 TTCAGTCCACCACTACACTGTGG - Intronic
918686209 1:187418902-187418924 TCCTGCCCTCCACTACAGTCTGG + Intergenic
918971792 1:191429222-191429244 GTTTGTCCTCTACCAAAGTGAGG + Intergenic
919847922 1:201653264-201653286 TTCTGTCCTCCAGGAAAAGGGGG + Intronic
922811071 1:228416127-228416149 TTCTGCCATCCCCTAAAGCGAGG + Intronic
924268526 1:242307573-242307595 GTCTGTCTGCCACTAAAGTCTGG + Intronic
1063108964 10:3018406-3018428 TTCTCTCCTCTACCAAGGTGGGG - Intergenic
1065882594 10:30049273-30049295 TTCCGTCCACCAGTGAAGTGGGG - Intronic
1066716377 10:38291189-38291211 GTCTGTCTGCCACTAAAGTCTGG - Intergenic
1067032666 10:42888812-42888834 TTCTTTCCTCCACTTAAGGAGGG - Intergenic
1074680504 10:115902148-115902170 TCTTGTCCTCCATTAAATTGCGG + Intronic
1075348949 10:121706527-121706549 TTCTGACCTCCACTTTAGAGAGG - Intergenic
1075433525 10:122412144-122412166 TTCTTTCATCCACTTTAGTGAGG + Intronic
1076534856 10:131170337-131170359 TTCTGTCTGCCACTCAAGGGAGG - Intronic
1078618509 11:12886560-12886582 TTGTGTTCTCCACCCAAGTGTGG - Intronic
1079798824 11:24843899-24843921 TTATGTCCTCCACGATTGTGAGG + Intronic
1081447696 11:43146226-43146248 TTCTCTCCTTCACTAAGGAGGGG - Intergenic
1085328454 11:75626838-75626860 TTCTGCCCTTCACTAGATTGTGG - Intronic
1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG + Intergenic
1088109372 11:106244902-106244924 CTCTCTCCTCCCCAAAAGTGAGG + Intergenic
1089587205 11:119517815-119517837 TTCTGTCCATCACAAGAGTGTGG + Intergenic
1090401310 11:126450009-126450031 TCCTGTCCTCCCCTATTGTGTGG - Intronic
1090558203 11:127899014-127899036 TTCAGTCCTCCACTGCACTGTGG - Intergenic
1094706496 12:32919276-32919298 TTCTTTTCTCCTCTGAAGTGGGG + Intergenic
1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG + Exonic
1098312143 12:69158833-69158855 TTGACTCCTCCACCAAAGTGGGG - Intergenic
1099043828 12:77690684-77690706 TTTTCTCCTCCATTAAAGTGGGG + Intergenic
1099992866 12:89744330-89744352 TTCTTTCCCCCACTGAATTGTGG + Intergenic
1100095731 12:91033288-91033310 TTCTGTACACCAATAAATTGTGG + Intergenic
1100297198 12:93274050-93274072 CTCTGTCCCCCTCTAAATTGCGG - Intergenic
1100591292 12:96032539-96032561 TTCTTTCCTCCACTAGATTGTGG - Intronic
1101683642 12:106994803-106994825 TTCTGTCCCTCACTCATGTGTGG + Intronic
1102840818 12:116119179-116119201 TTCCATCCTCCCCTACAGTGTGG + Intronic
1103222961 12:119261450-119261472 CTCTCTTCTCCACAAAAGTGCGG - Intergenic
1104582574 12:130021968-130021990 TTCAGTCCTCCACTGCACTGTGG + Intergenic
1105320551 13:19316675-19316697 TACTGTCATCCACTAGAGTCAGG + Intergenic
1106588790 13:31080296-31080318 TCCTGTCCACCTCTAAAATGTGG + Intergenic
1106910391 13:34457057-34457079 GTGTCTCCTCCACTAATGTGAGG + Intergenic
1107851866 13:44578233-44578255 TTCTGTCCTCCAGTTAAGGATGG - Intergenic
1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG + Intergenic
1111829697 13:93311735-93311757 TTCTGTCCTGCACTATACTCTGG + Intronic
1111911374 13:94316056-94316078 GCCTGTCATCCTCTAAAGTGGGG - Intronic
1113514059 13:110877690-110877712 TTCAATCATCCACTCAAGTGTGG + Intergenic
1116515360 14:45798486-45798508 TTCTGTTCTACATTACAGTGAGG + Intergenic
1123191849 14:106579172-106579194 TTCTGTCCTCCACCATCATGGGG - Intergenic
1123783789 15:23648637-23648659 TGCTGTCTTCCACTGATGTGTGG - Intergenic
1125908513 15:43415476-43415498 TTCTGTCCTGCTATAAAGTCGGG - Intronic
1126197010 15:45943534-45943556 TTATTTACTCCACAAAAGTGTGG - Intergenic
1128461018 15:67867200-67867222 TTTTGTCCTTTATTAAAGTGGGG - Intergenic
1129993283 15:79983257-79983279 TTCTATCAACCACAAAAGTGGGG - Intergenic
1132615401 16:839038-839060 TTCTGGCCTCCAGGACAGTGGGG - Intergenic
1133330025 16:4967137-4967159 TTCTGGCCTCCAGAACAGTGAGG - Intronic
1134319791 16:13152261-13152283 TTCTGTCCTCCATACAAGTCAGG + Intronic
1138321675 16:56119416-56119438 TTATTTCCTCCATTAAAGTCTGG + Intergenic
1144274930 17:13657164-13657186 GTCTGTTCCCCACTAAAATGAGG - Intergenic
1144754417 17:17670539-17670561 ATCTGGCCTCCGCCAAAGTGAGG - Intergenic
1147763573 17:42817496-42817518 GTGTGTCCTCCACTAGAGAGAGG + Intronic
1150203240 17:63378708-63378730 CTCTCTCCTCCACTAGATTGAGG - Intronic
1153616084 18:6935082-6935104 TTATGTCTTTCACTAAATTGGGG + Intergenic
1154332710 18:13442720-13442742 TGCTGTCCCCCACTAAGATGTGG - Intronic
1155855412 18:30828613-30828635 TTCTGTCCTCAACTAATGGTAGG + Intergenic
1156493359 18:37509844-37509866 TTCTGACATACACTACAGTGTGG + Intronic
1162001199 19:7746289-7746311 TCCTGTCCTGCCCTAGAGTGGGG + Intronic
1162003979 19:7765418-7765440 TCCTGTCCTGCTCTAGAGTGGGG - Intronic
1162508122 19:11100029-11100051 TTGTGTCCTCCACTGAATTTTGG + Intronic
1163864489 19:19761298-19761320 TTCTGTCCTACAGAGAAGTGTGG - Intergenic
1165368553 19:35386488-35386510 TTCTGTCCTAAAGTAAAATGAGG - Intergenic
1168521460 19:57054144-57054166 CTCTGTCTTCCACTTAAGGGAGG + Intergenic
926499714 2:13638592-13638614 TCTTGTCCTCAAGTAAAGTGGGG + Intergenic
928357272 2:30630044-30630066 TTCTGGCCTCCAGAACAGTGAGG - Intronic
928421521 2:31140586-31140608 TTTTGTCCTCTACTCAAGTGAGG + Intronic
928539293 2:32269371-32269393 TTCAGTCCTCCACTAGAGCTGGG - Intergenic
929523683 2:42679317-42679339 TTCTGTGCTCAACTAAGGCGGGG + Intronic
931249579 2:60517954-60517976 TTCTCTCCTCCCCTAAAATTGGG - Intronic
934559461 2:95305151-95305173 TTCTGTCACCCATTAAAATGAGG + Intronic
935515687 2:104035578-104035600 TTCTGTCATTCATTACAGTGTGG - Intergenic
935811959 2:106807243-106807265 ATCTGTCCTTCACTAGCGTGTGG - Intronic
936780444 2:116026561-116026583 TTCTGTCCTCCACATAAAGGTGG + Intergenic
940352670 2:152706505-152706527 TTCTGTGCTCCCATAAACTGAGG - Intronic
940443642 2:153750358-153750380 TTCTGTCCTCCTCTATATTTTGG + Intergenic
941677760 2:168362123-168362145 ATTTGTCCTCCATTAAAGTAGGG - Intergenic
943561339 2:189466849-189466871 TTCACTCCTCCACTAGAGGGAGG + Intronic
944285629 2:197946947-197946969 TTTTGTTCTCCTCTAGAGTGGGG - Intronic
944553665 2:200867495-200867517 TTATATCTTCCACTAAACTGAGG - Intergenic
944778119 2:202989821-202989843 TTCTGTCCTCCAGGAAAGACAGG - Intronic
944830573 2:203529983-203530005 TTCTGTTCTCCACAATAGAGAGG - Intronic
945510006 2:210689370-210689392 TTATCTCCTCCCCTAAAGTGGGG - Intergenic
945715254 2:213350585-213350607 TTTTCTCCTTCAGTAAAGTGTGG - Exonic
1172490406 20:35332144-35332166 TGCTGTTCGCCTCTAAAGTGTGG - Intronic
1173026591 20:39313050-39313072 TACTGTCTACCATTAAAGTGTGG + Intergenic
1174404360 20:50293965-50293987 TCCTCTCCTCCACCATAGTGAGG - Intergenic
1175279820 20:57795504-57795526 TTCCCTCCTCCATTAAAGTGTGG + Intergenic
1175308569 20:57995071-57995093 TTCTCCCCTCCACAAAAGTTGGG - Intergenic
1177542806 21:22517604-22517626 TTCTGCCCTTCATTAAAGAGAGG + Intergenic
1179349336 21:40593062-40593084 TTCTGCCCTAAACTGAAGTGTGG + Intronic
1181672637 22:24432879-24432901 GGGTGTCCTCCTCTAAAGTGAGG + Intronic
1182768524 22:32776257-32776279 TTCTGGCCTCCAGAAATGTGAGG + Intronic
1183150593 22:36034159-36034181 TTCTGTCCTGAACAAAATTGGGG - Intergenic
1183980110 22:41534369-41534391 TTCTGACATGCACTACAGTGTGG + Intronic
1184368947 22:44070403-44070425 TTCTTTATTCCACAAAAGTGGGG - Intronic
1184819630 22:46899891-46899913 TTGTGTGCTCCCCTAAAGTTTGG + Intronic
1184929756 22:47672396-47672418 CTCTGTCCACCACTAGAGTTAGG + Intergenic
950390796 3:12694922-12694944 TTCTCTCCACCACTAAAATTCGG + Intergenic
950782537 3:15404295-15404317 TCCTGTCCTCCTCAAATGTGTGG - Intronic
951392226 3:22120238-22120260 TTCTATCCTCCACAACTGTGAGG - Intronic
952144182 3:30513847-30513869 TTCTGTCCGACACTAAAATAAGG + Intergenic
953239408 3:41135337-41135359 TTAGCTTCTCCACTAAAGTGCGG - Intergenic
957268498 3:77999372-77999394 TTCTCTCCTCCACTAATTTAGGG + Intergenic
959083584 3:101827929-101827951 TTCAGTTCTCCACTCTAGTGAGG - Exonic
959223783 3:103555651-103555673 TTCTGTCCGCTACTCAGGTGTGG + Intergenic
962379443 3:134885741-134885763 TTCTCTCCTCCACCAGAGTCCGG - Intronic
969965780 4:10993913-10993935 TTCTGTCTTCCACTTAAGGATGG + Intergenic
972321319 4:37975992-37976014 TTATCTCCTCCCCTTAAGTGTGG + Intronic
972777217 4:42252678-42252700 ATCTCTCCTCTACTCAAGTGTGG - Intergenic
974973678 4:68862883-68862905 TTCTGTCTTGCAATAAAATGAGG + Intergenic
978109919 4:104950848-104950870 TTCTGTCCTCCAGTATATTTGGG + Intergenic
978786255 4:112612584-112612606 TTCTTTTCTCCATTACAGTGAGG - Exonic
981768502 4:148279351-148279373 TTCTGTCCTCCACCAAGTTTCGG - Intronic
984743589 4:183191613-183191635 TTCTGCTCCACACTAAAGTGCGG - Intronic
986055582 5:4133659-4133681 TCCTGTCCTCCACGCAAGAGAGG + Intergenic
986653659 5:9989586-9989608 TTCAGTCCTCAACCAAAGAGAGG + Intergenic
986747783 5:10759703-10759725 TGCTGTCCTCCGCTATAGGGCGG - Intronic
987227447 5:15857781-15857803 TTTTTTCCTCCAATAAAGTTAGG + Intronic
988679837 5:33474200-33474222 TCCTGTTCTCCACTAACCTGTGG - Intergenic
990815776 5:59783445-59783467 ATCTGTCTTCCACTACTGTGAGG + Intronic
990904741 5:60791991-60792013 TTCTGACCTGCATTAGAGTGTGG - Intronic
991437476 5:66611437-66611459 TTCTGTCCTCCTCTCATGAGAGG + Intronic
992152434 5:73918380-73918402 TCTTTTCCTCCACTTAAGTGAGG + Intronic
993007996 5:82448836-82448858 TTCTGTCCTTCACAAATGTAAGG - Intergenic
994242325 5:97439086-97439108 TTCTGTTCTTCATTAAAATGTGG + Intergenic
995775176 5:115717325-115717347 TCATGCCCTCCACTTAAGTGTGG - Intergenic
997317262 5:132947452-132947474 TTCTGACCTCCACTTGAATGGGG - Intronic
997357193 5:133270657-133270679 TTCTGCCCTGCAAGAAAGTGAGG + Intronic
999868984 5:155729981-155730003 CTCTGTACTCCACTGAAGGGAGG + Intergenic
1001306354 5:170576644-170576666 CTGTCTCCTCCACTAAAGTGGGG + Intronic
1005006440 6:21292014-21292036 TTCTGGCCTCCAGAACAGTGAGG - Intergenic
1013327466 6:109061918-109061940 TTCTGTCCTCCACTAAAGTGAGG - Intronic
1013955410 6:115835045-115835067 TTCAGTCCTCCACTGCACTGTGG - Intergenic
1015869464 6:137761184-137761206 TTCTAATCTCCACTAGAGTGGGG - Intergenic
1019090354 6:169526003-169526025 TTCTGTCCTCCACATATGAGGGG - Intronic
1019226616 6:170516254-170516276 CACTGTACTCCACTACAGTGTGG + Intergenic
1019896930 7:3990037-3990059 TGCTGTCCTGCACTACAGCGGGG + Intronic
1021741512 7:23690561-23690583 TTCTGGCCTCCATTACAATGTGG + Intronic
1024618006 7:51132229-51132251 TTCTGTCCCCCACTGCACTGTGG + Intronic
1024723545 7:52166438-52166460 TTATCTCCTACACTAAAGTAAGG + Intergenic
1026527024 7:71162711-71162733 CTGTGTCCTCCACTAGACTGAGG - Intronic
1027144959 7:75688114-75688136 CTCTCTCCTCCACTAAACTGAGG + Intronic
1027946500 7:84752467-84752489 TTTTCTCCTCCACTAATGTTGGG - Intergenic
1027948986 7:84788453-84788475 TTCTGACTCCCACTAAAGTCTGG - Intergenic
1031650322 7:124281053-124281075 TTTTTTCCTCCACTAACATGTGG + Intergenic
1032398836 7:131609840-131609862 TTATGTGCTCCAGTAAAATGTGG + Intergenic
1034228334 7:149499673-149499695 CTCTGTCCTCCACTGAAGACAGG + Intergenic
1034466653 7:151233702-151233724 GTCTGTCTTCCACTAAAAAGAGG - Exonic
1035065942 7:156105235-156105257 TTCCGTCTTCCACTCTAGTGGGG + Intergenic
1039337714 8:36611137-36611159 TTCTGACCTTCCCTGAAGTGGGG + Intergenic
1043926468 8:86042357-86042379 TTCTGTCCTCCAGAACTGTGAGG + Intronic
1044863740 8:96548898-96548920 TTCTGTCCCCCACGGAATTGGGG - Intronic
1045662229 8:104449859-104449881 TTCTGGCCTCCACAACTGTGAGG + Intronic
1050928015 9:11289981-11290003 TTCAGACCACCACTAAACTGTGG - Intergenic
1051389210 9:16545619-16545641 GTCTGTGCTCCACTCATGTGTGG - Intronic
1051478348 9:17532922-17532944 TTCTGTGCTCCATAAAAGTATGG - Intergenic
1055836655 9:80451384-80451406 CTCTGTACTCCAGTAAAGTAAGG - Intergenic
1055917401 9:81419348-81419370 TTCTATCCTCCAGAAATGTGAGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1186911032 X:14165913-14165935 TTCTTTCCTCCATTAATTTGTGG + Intergenic
1187573969 X:20534295-20534317 TGCTGTCCTCCACAAATCTGTGG - Intergenic
1192539341 X:71955037-71955059 TTCTGGCCACCAGGAAAGTGAGG - Intergenic
1194050276 X:89059584-89059606 TTCTTTCCTCCAGTATAGGGTGG + Intergenic
1196187177 X:112756937-112756959 TTCTCTCTTCCATTAAACTGAGG + Intergenic
1196211886 X:113004989-113005011 CTATGTGCTCCACTAAACTGTGG + Intergenic
1196329017 X:114446390-114446412 TTCTGTACTCCACTATTGTTGGG + Intergenic
1196779301 X:119368392-119368414 TTCTGTCCTCAAATAATGTGTGG - Intergenic