ID: 1013335481

View in Genome Browser
Species Human (GRCh38)
Location 6:109154912-109154934
Sequence AAGGGTACTAAAGGTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013335481_1013335485 8 Left 1013335481 6:109154912-109154934 CCTGCTACACCTTTAGTACCCTT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1013335485 6:109154943-109154965 CATCATAATGATTTTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013335481 Original CRISPR AAGGGTACTAAAGGTGTAGC AGG (reversed) Intronic
902692892 1:18121275-18121297 GAGGGACCTAAAGGAGTAGCTGG + Intronic
906175941 1:43772476-43772498 AAGGGCACCAAGCGTGTAGCTGG - Intronic
906745942 1:48222316-48222338 CAGGGAAGTAAAGGTGGAGCCGG - Intergenic
907418732 1:54332335-54332357 AAGGAAACTAAAAGTGGAGCAGG + Intronic
910214674 1:84831100-84831122 AAGGGTAAAAAAGGTTTAACTGG - Intronic
914928685 1:151910153-151910175 ATGGATACTAAAGGCGTAACAGG + Intergenic
921542290 1:216430960-216430982 AGGGGGACTAAATGTGTACCAGG - Intergenic
1080304331 11:30820214-30820236 AAGGGGATTACAGGTTTAGCTGG + Intergenic
1085136203 11:74091098-74091120 AAGGTTAATAAAGGTTTAACAGG + Intronic
1086738255 11:90334161-90334183 AGGGCTACTAAAGGGATAGCTGG - Intergenic
1088207579 11:107412127-107412149 AAAGGTTCTAAAGCTGTGGCTGG - Intronic
1105741019 13:23323038-23323060 ACGTGTAGTAAAGGTGTAGGTGG + Intronic
1105959891 13:25323116-25323138 AAAGGTACTAAAAGTCTAGTAGG + Intronic
1107764636 13:43721185-43721207 AAGGGTACTAAATTTGTATGTGG - Intronic
1110161911 13:72388677-72388699 AATGGTACAAAAAGTGTAGAAGG + Intergenic
1111698279 13:91653378-91653400 AAGGGTAGTAGGGGTGTAGAGGG + Intronic
1112178865 13:97056610-97056632 AGGGGTACTAAAGGGGTCCCAGG - Intergenic
1118876130 14:69786271-69786293 AAGGGCACAGAAGGTGGAGCAGG + Exonic
1118974152 14:70663161-70663183 AAGGGTAAAAAAGGTGAAGCTGG - Intronic
1122428700 14:101626478-101626500 AAGGGTACCAAGGGTGCAGCAGG + Intergenic
1124149675 15:27166497-27166519 TAGGGTAATAAAGGTCTTGCAGG + Intronic
1124895797 15:33776144-33776166 AAGCATACTCCAGGTGTAGCTGG - Intronic
1126107688 15:45157521-45157543 AGGGGTTCGAAAGGTGTGGCCGG + Intronic
1127104874 15:55602977-55602999 GAGGGTACTGAAGGTGAAGAAGG + Intergenic
1129079205 15:73024377-73024399 AAGGGTGCTTCAGGTGTGGCGGG - Intergenic
1129932552 15:79424288-79424310 AAGGGTACTTAAGGGATTGCTGG - Intronic
1138843983 16:60542801-60542823 AAGGGAAATAAGGGTGTAGAAGG + Intergenic
1142844807 17:2664748-2664770 AAGGGTACTCAAACTGTAGAAGG + Intronic
1143580219 17:7821239-7821261 AAGGGTACGGCAGGTGTACCTGG - Exonic
1148760884 17:49999339-49999361 GGGGGTACTAAAGGTGAAGCAGG + Intergenic
1149518006 17:57294975-57294997 AAGGATGCTAAAGGTGTTTCAGG + Intronic
1153972554 18:10239624-10239646 CAGGGGACTAAAGTTGCAGCAGG - Intergenic
1155067749 18:22282472-22282494 AAAGCTACTCAAGGTGTGGCTGG - Intergenic
1158939380 18:62393001-62393023 CAGGGTGCTAAAGGTGCACCTGG + Intergenic
1160055604 18:75476941-75476963 CTGGGTAATAAAGGTGTAACAGG - Intergenic
1160144559 18:76353032-76353054 AAGGATACAACAGGTGTAGAGGG + Intergenic
1163432068 19:17274171-17274193 AAGGATACTGAAGGTGGAACAGG - Exonic
1166342553 19:42147540-42147562 TTGGGCACTAAAGATGTAGCAGG - Intronic
926245837 2:11121951-11121973 CAGGGTCCTAAAGGAGCAGCGGG - Intergenic
927920115 2:26965724-26965746 TAGGGTACAAAAGGAGTAGAAGG + Intergenic
929162567 2:38847316-38847338 GAGGGTATGAAAGGTGTAACAGG - Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933509247 2:83218832-83218854 AAGGGGACCAAAGGTGAAGAAGG - Intergenic
938188152 2:129251773-129251795 ATGGGGACTACAGGTGTAGGAGG - Intergenic
939362032 2:141184814-141184836 AAGGGTATGTAAGGTGTAGGAGG - Intronic
944481719 2:200164190-200164212 AAGGCAACCAAAGGTGAAGCAGG + Intergenic
945689193 2:213011249-213011271 AAGGAGACTACAGGTGTACCTGG + Intronic
948304191 2:236934419-236934441 AAGGGTCCTAAAGGAGGGGCCGG - Intergenic
1177191438 21:17856223-17856245 AAGGGTAATCAAGCTGGAGCTGG - Intergenic
1178840978 21:36137124-36137146 AAGTGTTCTCAAGGTGTGGCTGG + Intronic
956245448 3:67177212-67177234 AAGGGTACTACAGGAGCAGGGGG - Intergenic
957933993 3:86919037-86919059 AAGGTTACTCAAGGAGTAGATGG + Intergenic
958475873 3:94581329-94581351 AAGGGTACTAATAGTGAAACAGG + Intergenic
961569739 3:127789127-127789149 AAGGGCATTAAAGGTGGGGCAGG + Intronic
961659859 3:128462958-128462980 AGGGTTACGGAAGGTGTAGCCGG + Exonic
962870401 3:139485179-139485201 AAGCATACTGAATGTGTAGCAGG + Intergenic
964611998 3:158624933-158624955 AAGTGTTCTAAAGGGGTCGCAGG + Intergenic
970420988 4:15905717-15905739 AAGGGCACTCATGGTGTAACTGG + Intergenic
970986058 4:22160101-22160123 AAGGGAACTAAAGAGGAAGCTGG - Intergenic
972518001 4:39827317-39827339 AAGCTTCCTGAAGGTGTAGCAGG - Intronic
973992513 4:56424237-56424259 AAGGGGTCTACAGCTGTAGCTGG - Intronic
978810988 4:112849695-112849717 AAGGGAACAAAAGATGAAGCTGG - Intronic
989291309 5:39769457-39769479 AAGGATACCAAAGGTGAAGACGG + Intergenic
991608534 5:68427325-68427347 CAGGGATCTAAATGTGTAGCTGG - Intergenic
993508714 5:88744748-88744770 AAGGGTAATAAAGAAGTAGCAGG - Intronic
998354950 5:141527251-141527273 AAGGTTACAAAAAGTTTAGCAGG + Intronic
998962707 5:147505801-147505823 AAGGGTTCTAGAGGTGTGGCAGG + Intronic
1000415086 5:160975991-160976013 AAAGGTCATAAAGGTCTAGCGGG - Intergenic
1013335481 6:109154912-109154934 AAGGGTACTAAAGGTGTAGCAGG - Intronic
1016581185 6:145630621-145630643 AAGGGTACCAGAGAAGTAGCTGG + Intronic
1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG + Intergenic
1017377341 6:153786616-153786638 CAGGGTACTAAAGTTATTGCAGG - Intergenic
1025101305 7:56137290-56137312 AAGGGTACTAGTGGTTTACCAGG - Intergenic
1027131879 7:75597067-75597089 AAGGGTACCAAACGTGATGCAGG + Intronic
1031897661 7:127370104-127370126 TAGGGAACTAAATGTGTAGGTGG - Exonic
1039631840 8:39121124-39121146 AAGAACACCAAAGGTGTAGCTGG + Intronic
1041666930 8:60454841-60454863 CAGAGTGCTACAGGTGTAGCAGG + Intergenic
1043678571 8:82993225-82993247 AAGGATACTAAAGGTCTTGAAGG - Intergenic
1045441513 8:102217861-102217883 AAGGGTAGAAAGGGTATAGCAGG + Intronic
1045967611 8:108043208-108043230 AAGTGTACTCAATTTGTAGCGGG + Intronic
1046315565 8:112496798-112496820 AAGGGTAGTAGAGGTGTTGGGGG + Intronic
1046738798 8:117806720-117806742 AAGGGTGCTGAAGGTGGAGATGG - Intronic
1047863738 8:128998167-128998189 AATGGTACTCCAAGTGTAGCTGG - Intergenic
1057190405 9:93084061-93084083 AAGAGTACTGAGGGTGGAGCAGG + Intronic
1186238463 X:7540446-7540468 AAGAGTGCTAATGGTGTATCAGG - Intergenic
1189376496 X:40470747-40470769 AAGGGCAATTAAAGTGTAGCAGG + Intergenic
1189420443 X:40852418-40852440 AAAGGTACTAAAAGTGTCACTGG - Intergenic
1190362007 X:49658334-49658356 GAGGGTACAAAAGGTACAGCAGG + Intergenic
1190983714 X:55481768-55481790 CAGGGAACTAAAGATGGAGCAGG + Intergenic
1196067013 X:111474869-111474891 AAGGGGAATAAAGGAGGAGCTGG - Intergenic
1199538644 X:148932523-148932545 AAGGCTTCTTAATGTGTAGCTGG - Intronic
1201741692 Y:17331213-17331235 AAGGGTACAAACTGTCTAGCAGG - Intergenic
1202073994 Y:21020384-21020406 AAGGTTTCTGCAGGTGTAGCTGG + Intergenic
1202078694 Y:21062239-21062261 AAGGTTTCTGCAGGTGTAGCTGG + Intergenic