ID: 1013336721

View in Genome Browser
Species Human (GRCh38)
Location 6:109170868-109170890
Sequence CCAAGCTACCAATTTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013336717_1013336721 -1 Left 1013336717 6:109170846-109170868 CCTTCATTTTCCCTGAAATGAAC No data
Right 1013336721 6:109170868-109170890 CCAAGCTACCAATTTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013336721 Original CRISPR CCAAGCTACCAATTTAAAGC TGG Intergenic
No off target data available for this crispr