ID: 1013338696

View in Genome Browser
Species Human (GRCh38)
Location 6:109191883-109191905
Sequence CCCAGTGGGGACCCCATATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013338696_1013338702 -9 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338702 6:109191897-109191919 CCCACTGGGGCACTGCCTAGTGG 0: 610
1: 1398
2: 1659
3: 1452
4: 1123
1013338696_1013338706 7 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
1013338696_1013338705 6 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG 0: 1581
1: 2034
2: 1486
3: 837
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013338696 Original CRISPR CCCAGTGGGGACCCCATATA GGG (reversed) Intergenic
No off target data available for this crispr