ID: 1013338696

View in Genome Browser
Species Human (GRCh38)
Location 6:109191883-109191905
Sequence CCCAGTGGGGACCCCATATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013338696_1013338706 7 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG No data
1013338696_1013338705 6 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG No data
1013338696_1013338702 -9 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338702 6:109191897-109191919 CCCACTGGGGCACTGCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013338696 Original CRISPR CCCAGTGGGGACCCCATATA GGG (reversed) Intergenic