ID: 1013338702

View in Genome Browser
Species Human (GRCh38)
Location 6:109191897-109191919
Sequence CCCACTGGGGCACTGCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013338696_1013338702 -9 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338702 6:109191897-109191919 CCCACTGGGGCACTGCCTAGTGG No data
1013338694_1013338702 -8 Left 1013338694 6:109191882-109191904 CCCCTATATGGGGTCCCCACTGG No data
Right 1013338702 6:109191897-109191919 CCCACTGGGGCACTGCCTAGTGG No data
1013338698_1013338702 -10 Left 1013338698 6:109191884-109191906 CCTATATGGGGTCCCCACTGGGG No data
Right 1013338702 6:109191897-109191919 CCCACTGGGGCACTGCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013338702 Original CRISPR CCCACTGGGGCACTGCCTAG TGG Intergenic