ID: 1013338705

View in Genome Browser
Species Human (GRCh38)
Location 6:109191912-109191934
Sequence CCTAGTGGAGCTGTGAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013338703_1013338705 -9 Left 1013338703 6:109191898-109191920 CCACTGGGGCACTGCCTAGTGGA No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG No data
1013338694_1013338705 7 Left 1013338694 6:109191882-109191904 CCCCTATATGGGGTCCCCACTGG No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG No data
1013338700_1013338705 -7 Left 1013338700 6:109191896-109191918 CCCCACTGGGGCACTGCCTAGTG No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG No data
1013338701_1013338705 -8 Left 1013338701 6:109191897-109191919 CCCACTGGGGCACTGCCTAGTGG No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG No data
1013338696_1013338705 6 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG No data
1013338698_1013338705 5 Left 1013338698 6:109191884-109191906 CCTATATGGGGTCCCCACTGGGG No data
Right 1013338705 6:109191912-109191934 CCTAGTGGAGCTGTGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013338705 Original CRISPR CCTAGTGGAGCTGTGAGAAG AGG Intergenic