ID: 1013338706

View in Genome Browser
Species Human (GRCh38)
Location 6:109191913-109191935
Sequence CTAGTGGAGCTGTGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013338700_1013338706 -6 Left 1013338700 6:109191896-109191918 CCCCACTGGGGCACTGCCTAGTG No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG No data
1013338696_1013338706 7 Left 1013338696 6:109191883-109191905 CCCTATATGGGGTCCCCACTGGG No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG No data
1013338698_1013338706 6 Left 1013338698 6:109191884-109191906 CCTATATGGGGTCCCCACTGGGG No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG No data
1013338703_1013338706 -8 Left 1013338703 6:109191898-109191920 CCACTGGGGCACTGCCTAGTGGA No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG No data
1013338694_1013338706 8 Left 1013338694 6:109191882-109191904 CCCCTATATGGGGTCCCCACTGG No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG No data
1013338701_1013338706 -7 Left 1013338701 6:109191897-109191919 CCCACTGGGGCACTGCCTAGTGG No data
Right 1013338706 6:109191913-109191935 CTAGTGGAGCTGTGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013338706 Original CRISPR CTAGTGGAGCTGTGAGAAGA GGG Intergenic