ID: 1013342068

View in Genome Browser
Species Human (GRCh38)
Location 6:109224625-109224647
Sequence GTCCTGTCCTATGTAATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013342066_1013342068 2 Left 1013342066 6:109224600-109224622 CCACTGTAACTTGATGTCACTTT No data
Right 1013342068 6:109224625-109224647 GTCCTGTCCTATGTAATTCTGGG No data
1013342065_1013342068 16 Left 1013342065 6:109224586-109224608 CCTTCAAATGTCTTCCACTGTAA No data
Right 1013342068 6:109224625-109224647 GTCCTGTCCTATGTAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013342068 Original CRISPR GTCCTGTCCTATGTAATTCT GGG Intergenic