ID: 1013342637

View in Genome Browser
Species Human (GRCh38)
Location 6:109230117-109230139
Sequence CACAATCAAGGTCAACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013342637_1013342650 30 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342650 6:109230170-109230192 TGGCATGTTCAGGATCTGCTGGG No data
1013342637_1013342641 -7 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342641 6:109230133-109230155 GATTGTGTCTTCTCAGGCATGGG No data
1013342637_1013342643 -5 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342643 6:109230135-109230157 TTGTGTCTTCTCAGGCATGGGGG No data
1013342637_1013342640 -8 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342640 6:109230132-109230154 TGATTGTGTCTTCTCAGGCATGG No data
1013342637_1013342644 10 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342644 6:109230150-109230172 CATGGGGGCCTGATACCCTGTGG No data
1013342637_1013342649 29 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342649 6:109230169-109230191 GTGGCATGTTCAGGATCTGCTGG No data
1013342637_1013342642 -6 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342642 6:109230134-109230156 ATTGTGTCTTCTCAGGCATGGGG No data
1013342637_1013342646 20 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342646 6:109230160-109230182 TGATACCCTGTGGCATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013342637 Original CRISPR CACAATCAAGGTCAACAGCC AGG (reversed) Intergenic
No off target data available for this crispr