ID: 1013342639

View in Genome Browser
Species Human (GRCh38)
Location 6:109230129-109230151
Sequence TGCCTGAGAAGACACAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013342639_1013342649 17 Left 1013342639 6:109230129-109230151 CCTTGATTGTGTCTTCTCAGGCA No data
Right 1013342649 6:109230169-109230191 GTGGCATGTTCAGGATCTGCTGG No data
1013342639_1013342644 -2 Left 1013342639 6:109230129-109230151 CCTTGATTGTGTCTTCTCAGGCA No data
Right 1013342644 6:109230150-109230172 CATGGGGGCCTGATACCCTGTGG No data
1013342639_1013342650 18 Left 1013342639 6:109230129-109230151 CCTTGATTGTGTCTTCTCAGGCA No data
Right 1013342650 6:109230170-109230192 TGGCATGTTCAGGATCTGCTGGG No data
1013342639_1013342646 8 Left 1013342639 6:109230129-109230151 CCTTGATTGTGTCTTCTCAGGCA No data
Right 1013342646 6:109230160-109230182 TGATACCCTGTGGCATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013342639 Original CRISPR TGCCTGAGAAGACACAATCA AGG (reversed) Intergenic
No off target data available for this crispr