ID: 1013342650

View in Genome Browser
Species Human (GRCh38)
Location 6:109230170-109230192
Sequence TGGCATGTTCAGGATCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013342637_1013342650 30 Left 1013342637 6:109230117-109230139 CCTGGCTGTTGACCTTGATTGTG No data
Right 1013342650 6:109230170-109230192 TGGCATGTTCAGGATCTGCTGGG No data
1013342639_1013342650 18 Left 1013342639 6:109230129-109230151 CCTTGATTGTGTCTTCTCAGGCA No data
Right 1013342650 6:109230170-109230192 TGGCATGTTCAGGATCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013342650 Original CRISPR TGGCATGTTCAGGATCTGCT GGG Intergenic
No off target data available for this crispr