ID: 1013343243

View in Genome Browser
Species Human (GRCh38)
Location 6:109236048-109236070
Sequence ACCAGAAGTATCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013343238_1013343243 13 Left 1013343238 6:109236012-109236034 CCAGATGCCAGCAGTACCTCCCA No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343235_1013343243 25 Left 1013343235 6:109236000-109236022 CCTGGCCTCTACCCAGATGCCAG No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343240_1013343243 -3 Left 1013343240 6:109236028-109236050 CCTCCCACTAAGTCATGACAACC No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343241_1013343243 -6 Left 1013343241 6:109236031-109236053 CCCACTAAGTCATGACAACCAGA No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343242_1013343243 -7 Left 1013343242 6:109236032-109236054 CCACTAAGTCATGACAACCAGAA No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343239_1013343243 6 Left 1013343239 6:109236019-109236041 CCAGCAGTACCTCCCACTAAGTC No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343237_1013343243 14 Left 1013343237 6:109236011-109236033 CCCAGATGCCAGCAGTACCTCCC No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343234_1013343243 26 Left 1013343234 6:109235999-109236021 CCCTGGCCTCTACCCAGATGCCA No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data
1013343236_1013343243 20 Left 1013343236 6:109236005-109236027 CCTCTACCCAGATGCCAGCAGTA No data
Right 1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013343243 Original CRISPR ACCAGAAGTATCTCCAGACA TGG Intergenic
No off target data available for this crispr