ID: 1013345238

View in Genome Browser
Species Human (GRCh38)
Location 6:109253770-109253792
Sequence CCTCTTCAGCAGTTAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013345234_1013345238 -9 Left 1013345234 6:109253756-109253778 CCCACACTAAGAACCCTCTTCAG No data
Right 1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG No data
1013345235_1013345238 -10 Left 1013345235 6:109253757-109253779 CCACACTAAGAACCCTCTTCAGC No data
Right 1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013345238 Original CRISPR CCTCTTCAGCAGTTAGTGTC TGG Intergenic
No off target data available for this crispr