ID: 1013345841

View in Genome Browser
Species Human (GRCh38)
Location 6:109259860-109259882
Sequence GATTCTCATTTTTAAGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013345839_1013345841 29 Left 1013345839 6:109259808-109259830 CCTAAATTCAGAAAAAAAATCTT No data
Right 1013345841 6:109259860-109259882 GATTCTCATTTTTAAGTGCTTGG No data
1013345840_1013345841 3 Left 1013345840 6:109259834-109259856 CCAGATATTTCATATTTGTCTTA No data
Right 1013345841 6:109259860-109259882 GATTCTCATTTTTAAGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013345841 Original CRISPR GATTCTCATTTTTAAGTGCT TGG Intergenic
No off target data available for this crispr