ID: 1013346169

View in Genome Browser
Species Human (GRCh38)
Location 6:109262752-109262774
Sequence ATGTCTACAGGGCCTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013346169_1013346181 28 Left 1013346169 6:109262752-109262774 CCCACAAAAGGCCCTGTAGACAT No data
Right 1013346181 6:109262803-109262825 ATCAAGGGCCCGCTGTGGCCAGG No data
1013346169_1013346176 13 Left 1013346169 6:109262752-109262774 CCCACAAAAGGCCCTGTAGACAT No data
Right 1013346176 6:109262788-109262810 CTACCACCAACCATTATCAAGGG No data
1013346169_1013346175 12 Left 1013346169 6:109262752-109262774 CCCACAAAAGGCCCTGTAGACAT No data
Right 1013346175 6:109262787-109262809 CCTACCACCAACCATTATCAAGG No data
1013346169_1013346182 29 Left 1013346169 6:109262752-109262774 CCCACAAAAGGCCCTGTAGACAT No data
Right 1013346182 6:109262804-109262826 TCAAGGGCCCGCTGTGGCCAGGG No data
1013346169_1013346180 23 Left 1013346169 6:109262752-109262774 CCCACAAAAGGCCCTGTAGACAT No data
Right 1013346180 6:109262798-109262820 CCATTATCAAGGGCCCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013346169 Original CRISPR ATGTCTACAGGGCCTTTTGT GGG (reversed) Intergenic
No off target data available for this crispr